Normal skin and hypertrophic scar fibroblasts differentially regulate collagen and fibronectin expression as well as mitochondrial membrane potential in response to basic fibroblast growth factor

Basic fibroblast growth factor (bFGF) regulates skin wound healing; however, the underlying mechanism remains to be defined. In the present study, we determined the effects of bFGF on the regulation of cell growth as well as collagen and fibronectin expression in fibroblasts from normal human skin and from hypertrophic scars. We then explored the involvement of mitochondria in mediating bFGF-inducedeffects on the fibroblasts. We isolated and cultivated normal and hypertrophic scar fibroblasts from tissue biopsies of patients who underwent plastic surgery for repairing hypertrophic scars. The fibroblasts were then treated with different concentrations of bFGF (ranging from 0.1 to 1000 ng/mL). The growth of hypertrophic scar fibroblasts became slower with selective inhibition of type I collagen production after exposure to bFGF. However, type III collagen expression was affected in both normal and hypertrophic scar fibroblasts. Moreover, fibronectin expression in the normal fibroblasts was up-regulated after bFGF treatment. bFGF (1000 ng/mL) also induced mitochondrial depolarization in hypertrophic scar fibroblasts (P < 0.01). The cellular ATP level decreased in hypertrophic scar fibroblasts (P < 0.05), while it increased in the normal fibroblasts following treatment with bFGF (P < 0.01). These data suggest that bFGF has differential effects and mechanisms on fibroblasts of the normal skin and hypertrophic scars, indicating that bFGF may play a role in the early phase of skin wound healing and post-burn scar formation.

Prolonged acceptance of skin grafts induced by B cells places regulatory T cells on the histopathology scene

The participation of regulatory T (Treg) cells in B cell-induced T cell tolerance has been claimed in different models. In skin grafts, naive B cells were shown to induce graft tolerance. However, neither the contribution of Treg cells to B cell-induced skin tolerance nor their contribution to the histopathological diagnosis of graft acceptance has been addressed. Here, using male C57BL/6 naive B cells to tolerize female animals, we show that skin graft tolerance is dependent on CD25+ Treg cell activity and independent of B cell-derived IL-10. In fact, B cells from IL-10-deficient mice were able to induce skin graft tolerance while Treg depletion of the host inhibited 100% graft survival. We questioned how Treg cell-mediated tolerance would impact on histopathology. B cell-tolerized skin grafts showed pathological scores as high as a rejected skin from naive, non-tolerized mice due to loss of skin appendages, reduced keratinization and mononuclear cell infiltrate. However, in tolerized mice, 40% of graft infiltrating CD4+ cells were FoxP3+ Treg cells with a high Treg:Teff (effector T cell) ratio (6:1) as compared to non-tolerized mice where Tregs comprise less than 8% of total infiltrating CD4 cells with a Treg:Teff ratio below 1:1. These results render Treg cells an obligatory target for histopathological studies on tissue rejection that may help to diagnose and predict the outcome of a transplanted organ.

Relationship of macrophage migration inhibitory factor levels in PBMCs, lesional skin and serum with disease severity and activity in vitiligo vulgaris

Melanocyte loss in vitiligo vulgaris is believed to be an autoimmune process. Macrophage migration inhibitory factor (MIF) is involved in many autoimmune skin diseases. We determined the possible role of MIF in the pathogenesis of vitiligo vulgaris, and describe the relationship between MIF expressions and disease severity and activity. Serum MIF concentrations and mRNA levels in PBMCs were measured in 44 vitiligo vulgaris patients and 32 normal controls, using ELISA and real-time RT-PCR. Skin biopsies from 15 patients and 6 controls were analyzed by real-time RT-PCR. Values are reported as median (25th-75th percentile). Serum MIF concentrations were significantly increased in patients [35.81 (10.98-43.66) ng/mL] compared to controls [7.69 (6.01-9.03) ng/mL]. MIF mRNA levels were significantly higher in PBMCs from patients [7.17 (3.59-8.87)] than controls [1.67 (1.23-2.42)]. There was also a significant difference in MIF mRNA levels in PBMCs between progressive and stable patients [7.86 (5.85-9.13)vs 4.33 (2.23-8.39)] and in serum MIF concentrations [40.47 (27.71-46.79) vs 26.80 (10.55-36.07) ng/mL]. In addition, the vitiligo area severity index scores of patients correlated positively with changes of both serum MIF concentrations (r = 0.488) and MIF mRNA levels in PBMCs (r = 0.426). MIF mRNA levels were significantly higher in lesional than in normal skin [2.43 (2.13-7.59)vs 1.18 (0.94-1.83)] and in patients in the progressive stage than in the stable stage [7.52 (2.43-8.84)vs 2.13 (1.98-2.64)]. These correlations suggest that MIF participates in the pathogenesis of vitiligo vulgaris and may be useful as an index of disease severity and activity.

Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

High prevalence of methicillin resistance and PVL genes amongStaphylococcus aureus isolates from the nares and skin lesions of pediatric patients with atopic dermatitis

Staphylococcus aureus is highly prevalent among patients with atopic dermatitis (AD), and this pathogen may trigger and aggravate AD lesions. The aim of this study was to determine the prevalence of S. aureus in the nares of pediatric subjects and verify the phenotypic and molecular characteristics of the isolates in pediatric patients with AD. Isolates were tested for antimicrobial susceptibility, SCCmectyping, and Panton-Valentine Leukocidin (PVL) genes. Lineages were determined by pulsed-field gel electrophoresis and multilocus sequence typing (MLST). AD severity was assessed with the Scoring Atopic Dermatitis (SCORAD) index. Among 106 patients, 90 (85%) presented S. aureus isolates in their nares, and 8 also presented the pathogen in their skin infections. Two patients had two positive lesions, making a total of 10 S. aureusisolates from skin infections. Methicillin-resistant S. aureus(MRSA) was detected in 24 (26.6%) patients, and PVL genes were identified in 21 (23.3%), including 6 (75%) of the 8 patients with skin lesions but mainly in patients with severe and moderate SCORAD values (P=0.0095). All 24 MRSA isolates were susceptible to trimethoprim/sulfamethoxazole, while 8 isolates had a minimum inhibitory concentration (MIC) to mupirocin >1024 μg/mL. High lineage diversity was found among the isolates including USA1100/ST30, USA400/ST1, USA800/ST5, ST83, ST188, ST718, ST1635, and ST2791. There was a high prevalence of MRSA and PVL genes among the isolates recovered in this study. PVL genes were found mostly among patients with severe and moderate SCORAD values. These findings can help clinicians improve the therapies and strategies for the management of pediatric patients with AD.

Physical and chemical properties of wami tilapia skin gelatin

Gelatin was extracted from the skin of tilapia (Oreochromis urolepis hornorum) and characterized according to its physical and chemical properties. It had pH 4.66, which is slightly higher than the values reported for gelatins processed by acid solubilization. In general, the ionic content was low, and the average yield of the process was 5.10 g/100 g. The proximal composition of the gelatin was similar to that of the commercial gelatins, with slightly higher moisture content. The tilapia skin gelatin had whitish-yellow color and average turbidity of 67 NTU.

Study of thermodynamic water properties and moisture sorption hysteresis of mango skin

The equilibrium moisture content for adsorption and desorption isotherms of mango skin was determined using the static gravimetric method at temperatures of 20, 26, 33, 38 and 44 oC in the 0.056 to 0.873 water activity range. Both sorption curves show a decrease in equilibrium moisture content as the temperature increasing. The hysteresis effect was observed at constant water activity. The Guggenheim, Anderson, and de Boer (GAB) model presented the best fitting accuracy among a group of models and was used to determine the thermodynamic properties of water sorption. Integral enthalpy and integral entropy areas showed inverted values for the adsorption and desorption isotherms over the wide range of water activity studied. These values confirm, in energetic terms, the difference between adsorption and desorption isotherms observed in the hysteresis phenomenon. Finally, the Gibbs free energy revealed that the sorption process was spontaneous for both sorption isotherms.

Stretching the drum skin : an analysis of power relations in leadership and succession in the Evangelical Lutheran church in Tanzania-Northern diocese 1942– 1993

-

Living in the Skin That I Am: An Organizational Autoethnography of an Adult Educator's Plight to Survive the Stigma of Invisible and Episodic Disability in an Academy of Administritiva

Through the reflective lens of an adult educator with invisible and episodic disabilities, this paper has been written as an organizational autoethnography. Through a process of autoethnographical sensemaking, it is intended to illuminate important gaps in organizational theory. Feminist/relational care ethics, critical reflection, and transformative learning serve as the educational theories that comprise its framework. In telling my story, embodied writing and performance narrative are used to convey the felt existence of a body exposed through words—where my “abled” and “disabled” professional teaching and learning identities may be studied against the backdrop of organizational policies and procedures. Words used to describe unfamiliar experiences and situations shape meaning for which new meaning may emerge. At the conclusion of this paper, an alternative frame of reference—a view from the margins—may be offered to articulate authenticity in the expectancy of workplace equity for adult educators with disabilities. Taken collectively on a larger level, it is hoped that this research may provide a source of inspiration for systemic organizational change in adult learning environments.

Examining the roles of core and local temperature on forearm skin blood flow

The interaction between local and reflexive control of skin blood flow (SkBF) is unclear. This thesis isolated the roles of rectal (Tre) and local (Tloc) temperature on forearm SkBF regulation at normal and elevated body temperatures, and to investigate the interaction between local and reflexive SkBF control. While either normothermic (Tre ~37.0°C) or hyperthermic (∆Tre +1.1°C), SkBF was assessed on the dorsal aspect of each forearm in 10 participants while Tloc was manipulated in an A-B-A-B fashion between neutral (33.0°C) and hot (38.5°C). Finally, local heating to 44°C was performed to elicit maximal SkBF. Data are presented as a percentage of maximal cutaneous vascular conductance (CVC), calculated as laser-Doppler flux divided by mean arterial pressure. Tloc manipulations performed during normothermia had significantly greater effects on CVC than during hyperthermia. The decreased modification to SkBF from the Tloc changes during hyperthermia suggests that strong reflexive vasodilation attenuates local SkBF control mechanisms.

Registered Nurses' Perceptions about Facilitators and Barriers to Maternal Skin to Skin Contact in the Operating Room

Abstract It is recommended that all new mothers experience skin-to-skin contact (SSC) with their newborns immediately after birth. However, SSC is not commonly practiced after cesarean deliveries. To understand facilitators and barriers regarding SSC in the operating room (OR), a descriptive online and paper survey was conducted with 68 Registered Nurses from four hospitals in Ontario. The theory of planned behavior framed the study. Nurses had positive attitudes, and believed most health care team members supported SSC in the OR, but were uncertain about their control over the behavior. Nurses who had practiced the behavior in the past had more positive attitudinal and normative beliefs, and perceived some barriers as less difficult. Attitude and past behavior were the only significant multivariate predictors of intention to practice SSC in the future. Results suggest that shifting attitude and supporting more experience with the practice may increase nurses’ implementation of SSC in the OR.

Encodage des forces tactiles dans le cortex somatosensoriel primaire

Les deux fonctions principales de la main sont la manipulation d’objet et l’exploration tactile. La détection du glissement, rapportée par les mécanorécepteurs de la peau glabre, est essentielle pour l’exécution de ces deux fonctions. Durant la manipulation d’objet, la détection rapide du micro-glissement (incipient slip) amène la main à augmenter la force de pince pour éviter que l’objet ne tombe. À l’opposé, le glissement est un aspect essentiel à l’exploration tactile puisqu’il favorise une plus grande acuité tactile. Pour ces deux actions, les forces normale et tangentielle exercées sur la peau permettent de décrire le glissement mais également ce qui arrive juste avant qu’il y ait glissement. Toutefois, on ignore comment ces forces contrôlées par le sujet pourraient être encodées au niveau cortical. C’est pourquoi nous avons enregistré l’activité unitaire des neurones du cortex somatosensoriel primaire (S1) durant l’exécution de deux tâches haptiques chez les primates. Dans la première tâche, deux singes devaient saisir une pastille de métal fixe et y exercer des forces de cisaillement sans glissement dans une de quatre directions orthogonales. Des 144 neurones enregistrés, 111 (77%) étaient modulés à la direction de la force de cisaillement. L’ensemble de ces vecteurs préférés s’étendait dans toutes les directions avec un arc variant de 50° à 170°. Plus de 21 de ces neurones (19%) étaient également modulés à l’intensité de la force de cisaillement. Bien que 66 neurones (59%) montraient clairement une réponse à adaptation lente et 45 autres (41%) une réponse à adaptation rapide, cette classification ne semblait pas expliquer la modulation à l’intensité et à la direction de la force de cisaillement. Ces résultats montrent que les neurones de S1 encodent simultanément la direction et l’intensité des forces même en l’absence de glissement. Dans la seconde tâche, deux singes ont parcouru différentes surfaces avec le bout des doigts à la recherche d’une cible tactile, sans feedback visuel. Durant l’exploration, les singes, comme les humains, contrôlaient les forces et la vitesse de leurs doigts dans une plage de valeurs réduite. Les surfaces à haut coefficient de friction offraient une plus grande résistance tangentielle à la peau et amenaient les singes à alléger la force de contact, normale à la peau. Par conséquent, la somme scalaire des composantes normale et tangentielle demeurait constante entre les surfaces. Ces observations démontrent que les singes contrôlent les forces normale et tangentielle qu’ils appliquent durant l’exploration tactile. Celles-ci sont également ajustées selon les propriétés de surfaces telles que la texture et la friction. Des 230 neurones enregistrés durant la tâche d’exploration tactile, 96 (42%) ont montré une fréquence de décharge instantanée reliée aux forces exercées par les doigts sur la surface. De ces neurones, 52 (54%) étaient modulés avec la force normale ou la force tangentielle bien que l’autre composante orthogonale avait peu ou pas d’influence sur la fréquence de décharge. Une autre sous-population de 44 (46%) neurones répondait au ratio entre la force normale et la force tangentielle indépendamment de l’intensité. Plus précisément, 29 (30%) neurones augmentaient et 15 (16%) autres diminuaient leur fréquence de décharge en relation avec ce ratio. Par ailleurs, environ la moitié de tous les neurones (112) étaient significativement modulés à la direction de la force tangentielle. De ces neurones, 59 (53%) répondaient à la fois à la direction et à l’intensité des forces. L’exploration de trois ou quatre différentes surfaces a permis d’évaluer l’impact du coefficient de friction sur la modulation de 102 neurones de S1. En fait, 17 (17%) neurones ont montré une augmentation de leur fréquence de décharge avec l’augmentation du coefficient de friction alors que 8 (8%) autres ont montré le comportement inverse. Par contre, 37 (36%) neurones présentaient une décharge maximale sur une surface en particulier, sans relation linéaire avec le coefficient de friction des surfaces. La classification d’adaptation rapide ou lente des neurones de S1 n’a pu être mise en relation avec la modulation aux forces et à la friction. Ces résultats montrent que la fréquence de décharge des neurones de S1 encode l’intensité des forces normale et tangentielle, le ratio entre les deux composantes et la direction du mouvement. Ces résultats montrent que le comportement d’une importante sous-population des neurones de S1 est déterminé par les forces normale et tangentielle sur la peau. La modulation aux forces présentée ici fait le pont entre les travaux évaluant les propriétés de surfaces telles que la rugosité et les études touchant à la manipulation d’objets. Ce système de référence s’applique en présence ou en absence de glissement entre la peau et la surface. Nos résultats quant à la modulation des neurones à adaptation rapide ou lente nous amènent à suggérer que cette classification découle de la manière que la peau est stimulée. Nous discuterons aussi de la possibilité que l’activité des neurones de S1 puisse inclure une composante motrice durant ces tâches sensorimotrices. Finalement, un nouveau cadre de référence tridimensionnel sera proposé pour décrire et rassembler, dans un même continuum, les différentes modulations aux forces normale et tangentielle observées dans S1 durant l’exploration tactile.

Indigenous knowledges and power in friction with human rights and development discourses : the case of the Witoto Ethnic Safeguarding Plan in the Colombian Amazon

Cette thèse analyse les négociations interculturelles des Gens du Centre (groupe amazonien multi-ethnique) avec les discours universels de droits humains et de développement mobilisés par l’État colombien. L’analyse se concentre sur le Plan de sauvegarde ethnique Witoto chapitre Leticia (ESP), qui est un des 73 plans formulés et implémentés par l’État colombien pour reconnaître les droits des peuples autochtones en danger par le déplacement forcé causé par les conflits armés internes. J’analyse l’ESP à travers la notion de friction (Tsing, 2005) qui fait référence aux caractéristiques complexes, inégalitaires et changeantes des rencontres contemporaines entre les différences des savoirs locaux et globaux. Mon analyse se base aussi sur des approches foucaldiennes et/ou subalternes de pouvoir comme la recherche anticoloniale et de la décolonisation, les perspectives critiques et contre-hégémoniques des droits humains, le post-développement, et les critiques du féminisme au développement. L’objectif de la thèse est d’analyser les savoirs (concepts de loi, de justice et de développement); les logiques de pensée (pratiques, épistémologies, rôles et espaces pour partager et produire des savoirs); et les relations de pouvoir (formes de leadership, associations, réseaux, et formes d’empowerment et disempowerment) produits et recréés par les Gens du Centre au sein des frictions avec les discours de droits humains et du développement. La thèse introduit comment la région habitée par les Gens du Centre (le Milieu Amazone transfrontalier) a été historiquement connectée aux relations inégalitaires de pouvoir qui influencent les luttes actuelles de ce groupe autochtone pour la reconnaissance de leurs droits à travers l’ESP. L’analyse se base à la fois sur une recherche documentaire et sur deux terrains ethnographiques, réalisés selon une perspective critique et autoréflexive. Ma réflexion méthodologique explore comment la position des chercheurs sur le terrain influence le savoir ethnographique et peut contribuer à la création des relations interculturelles inclusives, flexibles et connectées aux besoins des groupes locaux. La section analytique se concentre sur comment le pouvoir circule simultanément à travers des échelles nationale, régionale et locale dans l’ESP. J’y analyse comment ces formes de pouvoir produisent des sujets individuels et collectifs et s’articulent à des savoirs globaux ou locaux pour donner lieu à de nouvelles formes d’exclusion ou d’émancipation des autochtones déplacés. Les résultats de la recherche suggèrent que les Gens du Centre approchent le discours des droits humains à travers leurs savoirs autochtones sur la « loi de l’origine ». Cette loi établit leur différence culturelle comme étant à la base du processus de reconnaissance de leurs droits comme peuple déplacé. D’ailleurs, les Gens du Centre approprient les discours et les projets de développement à travers la notion d’abondance qui, comprise comme une habileté collective qui connecte la spiritualité, les valeurs culturelles, et les rôles de genre, contribue à assurer l’existence physique et culturelle des groupes autochtones. Ma thèse soutient que, même si ces savoirs et logiques de pensée autochtones sont liés à des inégalités et à formes de pouvoir local, ils peuvent contribuer à des pratiques de droits humains et de développement plurielles, égalitaires et inclusives.

Optimization of Process Parameters for the Extraction of Gelatin from the Skin of Freshwater Fish and the Evaluation of Physical anal Chemical Characteristics

Faculty of Marine Sciences,Cochin University of Science and Technology