952 resultados para Phase formation


Relevância:

20.00% 20.00%

Publicador:

Resumo:

The development of technological routes to convert lignocellulosic biomass to liquid fuels requires an in-depth understanding of the cell wall architecture of substrates. Essential pretreatment processes are conducted to reduce biomass recalcitrance and usually increase the reactive surface area. Quantitative three-dimensional information about both bulk and surface structural features of substrates needs to be obtained to expand our knowledge of substrates. In this work, phase-contrast tomography (PCT) was used to gather information about the structure of a model lignocellulosic biomass (piassava fibers). The three-dimensional cellular organization of piassava fibers was characterized by PCT using synchrotron radiation. This technique enabled important physical features that describe the substrate piassava fibers to be visualized and quantified. The external surface area of a fiber and internal surface area of the pores in a fiber could be determined separately. More than 96% of the overall surface area available to enzymes was in the bulk substrate. The pore surface area and length exhibited a positive linear relationship, where the slope of this relationship depended on the plant tissue. We demonstrated that PCT is a powerful tool for the three-dimensional characterization of the cell wall features related to biomass recalcitrance. Original and relevant quantitative information about the structural features of the analyzed material were obtained. The data obtained by PCT can be used to improve processing routes to efficiently convert biomass feedstock into sugars.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Several biotechnological processes can show an undesirable formation of emulsions making difficult phase separation and product recovery. The breakup of oil-in-water emulsions stabilized by yeast was studied using different physical and chemical methods. These emulsions were composed by deionized water, hexadecane and commercial yeast (Saccharomyces cerevisiae). The stability of the emulsions was evaluated varying the yeast concentration from 7.47 to 22.11% (w/w) and the phases obtained after gravity separation were evaluated on chemical composition, droplet size distribution, rheological behavior and optical microscopy. The cream phase showed kinetic stability attributed to mechanisms as electrostatic repulsion between the droplets, a possible Pickering-type stabilization and the viscoelastic properties of the concentrated emulsion. Oil recovery from cream phase was performed using gravity separation, centrifugation, heating and addition of demulsifier agents (alcohols and magnetic nanoparticles). Long centrifugation time and high centrifugal forces (2h/150,000×g) were necessary to obtain a complete oil recovery. The heat treatment (60°C) was not enough to promote a satisfactory oil separation. Addition of alcohols followed by centrifugation enhanced oil recovery: butanol addition allowed almost complete phase separation of the emulsion while ethanol addition resulted in 84% of oil recovery. Implementation of this method, however, would require additional steps for solvent separation. Addition of charged magnetic nanoparticles was effective by interacting electrostatically with the interface, resulting in emulsion destabilization under a magnetic field. This method reached almost 96% of oil recovery and it was potentially advantageous since no additional steps might be necessary for further purifying the recovered oil.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

By the year 2005 the world biochemical market will reach an estimated $ 100 billion and separation processes are a vital link between lab discoveries and the fulfillment of this commercialization potential. The practical application of aqueous two-phase systems (ATPS) to extraction processes has been exploited for several years for the recovery of biological products. Unfortunately, this has not resulted in an extensive presence of the technique in commercial processes. In this paper a critical overview of the fundamental thermodynamic properties related to formation of aqueous two-phase systems and their application to extraction and purification of bioparticules is presented.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física

Relevância:

20.00% 20.00%

Publicador:

Resumo:

This study aimed to evaluate the effects of a flavor-containing dentifrice on the formation of volatile sulphur compounds (VSCs) in morning bad breath. A two-step, blinded, crossover, randomized study was carried out in 50 dental students with a healthy periodontium divided into two experimental groups: flavor-containing dentifrice (test) and non-flavor-containing dentifrice (control). The volunteers received the designated dentifrice and a new toothbrush for a 3 X/day brushing regimen for 2 periods of 30 days. A seven-day washout interval was used between the periods. The assessed parameters were: plaque index (PI), gingival index (GI), organoleptic breath scores (ORG), VSC levels (as measured by a portable sulphide monitor) before (H1) and after (H2) cleaning of the tongue, tongue coating (TC) wet weight and BANA test from TC samples. The intra-group analysis showed a decrease in ORG, from 3 to 2, after 30 days for the test group (p < 0.05). The inter-group analysis showed lower values in ORG, H1 and H2 for the test group (p < 0.05). There was no difference between the amount of TC between groups and the presence of flavor also did not interfere in the BANA results between groups (p > 0.05). These findings suggest that a flavor-containing dentifrice seems to prevent VSCs formation in morning bad breath regardless of the amount of TC in periodontally healthy subjects.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

PURPOSE: Dental fusion is defined as the union of two dental germs at some stage of their development. The aim of this article is to report the endodontic treatment of two clinical cases of dental fusion. CASE DESCRIPTION: In the first case, the patient was referred by an orthodontist for endodontic treatment of tooth 12, which was fused to 13. Surgical separation and later replacement of the involved elements in the dental arch was indicated. In the second case, the patient sought dental attendance due to spontaneous pain. In the radiographic exam, gemination in tooth 11 and fusion of 21 with a supernumerary tooth was observed. The fused teeth were endodontically treated, and patients were referred to other dental specialties to reestablish esthetics and function. CONCLUSION: The dentist must be able to diagnose, differentiate and treat these dental anomalies adequately, with the goal of maintaining patients' oral health.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

PURPOSE: Juvenile idiopathic arthritis (JIA) has unknown etiology, and the involvement of the temporomandibular joint (TMJ) is rare in the early phase of the disease. The present article describes the use of computed tomography (CT) and magnetic resonance (MRI) images for the diagnosis of affected TMJ in JIA. CASE DESCRIPTION: A 12-year-old, female, Caucasian patient, with systemic rheumathoid arthritis and involvement of multiple joints was referred to the Imaging Center for TMJ assessment. The patient reported TMJ pain and limited opening of the mouth. The helical CT examination of the TMJ region showed asymmetric mandibular condyles, erosion of the right condyle and osteophyte-like formation. The MRI examination showed erosion of the right mandibular condyle, osteophytes, displacement without reduction and disruption of the articular disc. CONCLUSION: The disorders of the TMJ as a consequence of JIA must be carefully assessed by modern imaging methods such as CT and MRI. CT is very useful for the evaluation of discrete bone changes, which are not identified by conventional radiographs in the early phase of JIA. MRI allows the evaluation of soft tissues, the identification of acute articular inflammation and the differentiation between pannus and synovial hypertrophy.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The aim of this work was to study the effect of the hydrolysis degree (HD) and the concentration (C PVA) of two types of poly (vinyl alcohol) (PVA) and the effect of the type and the concentration of plasticizers on the phase properties of biodegradable films based on blends of gelatin and PVA, using a response-surface methodology. The films were made by casting and the studied properties were their glass (Tg) and melting (Tm) transition temperatures, which were determined by diferential scanning calorimetry (DSC). For the data obtained on the first scan, the fitting of the linear model was statistically significant and predictive only for the second melting temperature. In this case, the most important effect on the second Tm of the first scan was due to the HD of the PVA. In relation to the second scan, the linear model could be fit to Tg data with only two statistically significant parameters. Both the PVA and plasticizer concentrations had an important effect on Tg. Concerning the second Tm of the second scan, the linear model was fit to data with two statistically significant parameters, namely the HD and the plasticizer concentration. But, the most important effect was provoked by the HD of the PVA.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Aspects related to the nature of stem thickening in monocotyledons have been the subject of many studies. Primary thickening has been attributed to the Primary Thickening Meristem (PTM). According to most authors, it gives rise, besides the adventitious roots, to the vascular tissues and part of the cortex. In other words, it has centripetal and centrifugal activity. For some authors, however, it gives rise only to the vascular system, and for others, only to part of the cortex. However, this work demonstrated that PTM corresponds to the pericycle in the meristematic phase or to the pericycle associated with the endodermis, also with meristematic activity. It was observed that the pericycle was responsible for the formation of the vascular system of the rhizome and of the adventitious roots; the endodermis gave rise to cell layers with radial disposition which comprised the inner portion of the stem cortex, and which corresponded to the region known as the derivatives of the meristematic endodermis (DME). A continuity was also demonstrated between the tissues of the stem and root in species of Scleria Berg. (Cyperaceae).

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The activity of the antineoplastic drug tamoxifen was evaluated against Trypanosoma cruzi. In vitro activity was determined against epimastigote, trypomastigote and amastigote forms of CL14, Y and Y benznidazole resistant T. cruzi strains. Regardless of the strain used, the drug was active against all life-cycle stages of the parasite with a half maximal effective concentration ranging from 0.7-17.9 µM. Two experimental models of acute Chagas disease were used to evaluate the in vivo efficacy of treatment with tamoxifen. No differences in parasitemia and mortality were observed between control mock-treated and tamoxifen-treated mice.