964 resultados para Peroxide penetration
Resumo:
The biochemical responses of the enzymatic antioxidant system of a drought-tolerant cultivar (IACSP 94-2094) and a commercial cultivar in Brazil (IACSP 95-5000) grown under two levels of soil water restriction (70% and 30% Soil Available Water Content) were investigated. IACSP 94-2094 exhibited one additional active superoxide dismutase (Cu/Zn-SOD VI) isoenzyme in comparison to IACSP 95-5000, possibly contributing to the heightened response of IACSP 94-2094 to the induced stress. The total glutathione reductase (GR) activity increased substantially in IACSP 94-2094 under conditions of severe water stress; however, the appearance of a new GR isoenzyme and the disappearance of another isoenzyme were found not to be related to the stress response because the cultivars from both treatment groups (control and water restrictions) exhibited identical changes. Catalase (CAT) activity seems to have a more direct role in H2O2 detoxification under water stress condition and the shift in isoenzymes in the tolerant cultivar might have contributed to this response, which may be dependent upon the location where the excessive H2O2 is being produced under stress. The improved performance of IACSP 94-2094 under drought stress was associated with a more efficient antioxidant system response, particularly under conditions of mild stress.
Resumo:
Aware of the diffusion capacity of bleaching in the dental tissues, many orthodontists are subjecting their patients to dental bleaching during orthodontic treatment for esthetic purposes or to anticipate the exchange of esthetic restorations after the orthodontic treatment. For this purpose specific products have been developed in pre-loaded whitening trays designed to fit over and around brackets and wires, with clinical efficacy proven. The objective of this study was to evaluate, through spectrophotometric reflectance, the effectiveness of dental bleaching under orthodontic bracket. Thirty-two bovine incisors crown blocks of 8 mm x 8 mm height lengths were used. Staining of tooth blocks with black tea was performed for six days. They were distributed randomly into 4 groups (1-home bleaching with bracket, 2- home bleaching without bracket, 3- office bleaching with bracket, 4 office bleaching without bracket). The color evaluation was performed (CIE L * a * b *) using color reflectance spectrophotometer. Metal brackets were bonded in groups 1 and 3. The groups 1 and 2 samples were subjected to the carbamide peroxide at 15%, 4 hours daily for 21 days. Groups 3 and 4 were subjected to 3 in-office bleaching treatment sessions, hydrogen peroxide 38%. After removal of the brackets, the second color evaluation was performed in tooth block, difference between the area under the bracket and around it, and after 7 days to verified color stability. Data analysis was performed using the paired t-test and two-way variance analysis and Tukey's. The home bleaching technique proved to be more effective compared to the office bleaching. There was a significant difference between the margin and center color values of the specimens that were subjected to bracket bonding. The bracket bond presence affected the effectiveness of both the home and office bleaching treatments. Key words:Tooth bleaching, spectrophotometry, orthodontics.
Resumo:
Previous studies from our group have demonstrated the protective effect of S-nitroso-N-acetylcysteine (SNAC) on the cardiovascular system in dyslipidemic LDLr-/- mice that develop atheroma and left ventricular hypertrophy after 15 days on a high fat diet. We have shown that SNAC treatment attenuates plaque development via the suppression of vascular oxidative stress and protects the heart from structural and functional myocardial alterations, such as heart arrhythmia, by reducing cardiomyocyte sensitivity to catecholamines. Here we investigate the ability of SNAC to modulate oxidative stress and cell survival in cardiomyocytes during remodeling and correlation with β₂-AR signaling in mediating this protection. Ventricular superoxide (O₂⁻) and hydrogen peroxide (H₂O₂) generation was measured by HPLC methods to allow quantification of dihydroethidium (DHE) products. Ventricular histological sections were stained using terminal dUTP nick-end labeling (TUNEL) to identify nuclei with DNA degradation (apoptosis) and this was confirmed by Western blot for cleaved caspase-3 and caspase-7 protein expression. The findings show that O₂⁻ and H₂O₂ production and also cell apoptosis were increased during left ventricular hypertrophy (LVH). SNAC treatment reduced oxidative stress during on cardiac remodeling, measured by decreased H₂O₂ and O₂⁻ production (65% and 52%, respectively), and a decrease in the ratio of p-Ser1177 eNOS/total eNOS. Left ventricle (LV) from SNAC-treated mice revealed a 4-fold increase in β₂-AR expression associated with coupling change to Gi; β₂-ARs-S-nitrosation (β₂-AR-SNO) increased 61%, while apoptosis decreased by 70%. These results suggest that the cardio-protective effect of SNAC treatment is primarily through its anti-oxidant role and is associated with β₂-ARs overexpression and β₂-AR-SNO via an anti-apoptotic pathway.
Resumo:
Chronic and systemic treatment of rodents with rotenone, a classical inhibitor of mitochondrial respiratory complex I, results in neurochemical, behavioral, and neuropathological features of Parkinson's disease. The aim of the present study was to evaluate whether brain mitochondria from old rats (24 months old) would be more susceptible to rotenone-induced inhibition of oxygen consumption and increased generation of H2O2 than mitochondria from young-adult rats (3-4 months old). Isolated brain mitochondria were incubated in the presence of different rotenone concentrations (5, 10, and 100nM), and oxygen consumption and H2O2 production were measured during respiratory states 3 (ADP-stimulated respiration) and 4 (resting respiration). Respiratory state 3 and citrate synthase activity were significantly lower in mitochondria from old rats. Mitochondria from young-adult and old rats showed similar sensitivity to rotenone-induced inhibition of oxygen consumption. Similarly, H2O2 production rates by both types of mitochondria were dose-dependently stimulated to the same extent by increasing concentrations of rotenone. We conclude that rotenone exerts similar effects on oxygen consumption and H2O2 production by isolated brain mitochondria from young-adult and old rats. Therefore, aging does not increase the mitochondrial H2O2 generation in response to complex I inhibition.
Resumo:
The aim of this study was to evaluate the differential sensitivity of sugarcane genotypes to H2O2 in root medium. As a hypothesis, the drought tolerant genotype would be able to minimize the oxidative damage and maintain the water transport from roots to shoots, reducing the negative effects on photosynthesis. The sugarcane genotypes IACSP94-2094 (drought tolerant) and IACSP94-2101 (drought sensitive) were grown in a growth chamber and exposed to three levels of H2O2 in nutrient solution: control; 3mmolL(-1) and 80mmolL(-1). Leaf gas exchange, photochemical activity, root hydraulic conductance (Lr) and antioxidant metabolism in both roots and leaves were evaluated after 15min of treatment with H2O2. Although, root hydraulic conductance, stomatal aperture, apparent electron transport rate and instantaneous carboxylation efficiency have been reduced by H2O2 in both genotypes, IACSP94-2094 presented higher values of those variables as compared to IACSP94-2101. There was a significant genotypic variation in relation to the physiological responses of sugarcane to increasing H2O2 in root tissues, being root changes associated with modifications in plant shoots. IACSP94-2094 presented a root antioxidant system more effective against H2O2 in root medium, regardless H2O2 concentration. Under low H2O2 concentration, water transport and leaf gas exchange of IACSP94-2094 were less affected as compared to IACSP94-2101. Under high H2O2 concentration, the lower sensitivity of IACSP94-2094 was associated with increases in superoxide dismutase activity in roots and leaves and increases in catalase activity in roots. In conclusion, we propose a general model of sugarcane reaction to H2O2, linking root and shoot physiological responses.
Resumo:
In our previous study, we have found that 5-cyclopropyl-2-[1-(2-fluoro-benzyl)-1H-pyrazolo[3,4-b]pyridine-3-yl]-pyrimidin-4-ylamine (BAY 41-2272), a guanylate cyclase agonist, activates human monocytes and the THP-1 cell line to produce the superoxide anion, increasing in vitro microbicidal activity, suggesting that this drug can be used to modulate immune functioning in primary immunodeficiency patients. In the present work, we investigated the potential of the in vivo administration of BAY 41-2272 for the treatment of Candida albicans and Staphylococcus aureus infections introduced via intraperitoneal and subcutaneous inoculation. We found that intraperitoneal treatment with BAY 41-2272 markedly increased macrophage-dependent cell influx to the peritoneum in addition to macrophage functions, such as spreading, zymosan particle phagocytosis and nitric oxide and phorbol myristate acetate-stimulated hydrogen peroxide production. Treatment with BAY 41-2272 was highly effective in reducing the death rate due to intraperitoneal inoculation of C. albicans, but not S. aureus. However, we found that in vitro stimulation of peritoneal macrophages with BAY 41-2272 markedly increased microbicidal activities against both pathogens. Our results show that the prevention of death by the treatment of C. albicans-infected mice with BAY 41-2272 might occur primarily by the modulation of the host immune response through macrophage activation.
Resumo:
Ofloxacin is an antimicrobial agent frequently found in significant concentrations in wastewater and surface water. Its continuous introduction into the environment is a potential risk to non-target organisms or to human health. In this study, ofloxacin degradation by UV/TiO2 and UV/TiO2/H2O2, antimicrobial activity (E. coli) of samples subjected to these processes, and by-products formed were evaluated. For UV/TiO2, the degradation efficiency was 89.3% in 60 min of reaction when 128 mg L(-1) TiO2 were used. The addition of 1.68 mmol L(-1) hydrogen peroxide increased degradation to 97.8%. For UV/TiO2, increasing the catalyst concentration from 4 to 128 mg L(-1) led to an increase in degradation efficiency. For both processes, the antimicrobial activity was considerably reduced throughout the reaction time. The structures of two by-products are presented: m/z 291 (9-fluoro-3-methyl-10-(methyleneamino)-7-oxo-2,3-dihydro-7H-[1,4]oxazino[2,3,4-ij]quinoline-6-carboxylic acid) and m/z 157 ((Z)-2-formyl-3-((2-oxoethyl)imino)propanoic acid).
Resumo:
The aim of this work is to obtain, purify and characterize biochemically a peroxidase from Copaifera langsdorffii leaves (COP). COP was obtained by acetone precipitation followed by ion-exchange chromatography. Purification yielded 3.5% of peroxidase with the purification factor of 46.86. The COP optimum pH is 6.0 and the temperature is 35 ºC. COP was stable in the pH range of 4.5 to 9.3 and at temperatures below 50.0 ºC. The apparent Michaelis-Menten constants (Km) for guaiacol and H2O2 were 0.04 mM and 0.39 mM respectively. Enzyme turnover was 0.075 s-1 for guaiacol and 0.28 s-1 for hydrogen peroxide. Copaifera langsdorffii leaves showed to be a rich source of active peroxidase (COP) during the whole year. COP could replace HRP, the most used peroxidase, in analytical determinations and treatment of industrial effluents at low cost.
Resumo:
This paper presents two techniques to evaluate soil mechanical resistance to penetration as an auxiliary method to help in a decision-making in subsoiling operations. The decision is based on the volume of soil mobilized as a function of the considered critical soil resistance to penetration in each case. The first method, probabilistic, uses statistical techniques to define the volume of soil to be mobilized. The other method, deterministic, determines the percentage of soil to be mobilized and its spatial distribution. Both cases plot the percentage curves of experimental data related to the soil mechanical resistance to penetration equal or larger to the established critical level and the volume of soil to be mobilized as a function of critical level. The deterministic method plots showed the spatial distribution of the data with resistance to penetration equal or large than the critical level. The comparison between mobilized soil curves as a function of critical level using both methods showed that they can be considered equivalent. The deterministic method has the advantage of showing the spatial distribution of the critical points.
Resumo:
This work was carried out with the objective of studying the spatial variability of the physical attributes of a Red-Yellow Ultisol under pasture and secondary vegetation in natural regeneration. Two areas were chosen in a hillside, with the soil sampling to the depth of 0-0.2 m, with the georeferenced points in a regular grid of 10x10 m, totalizing 64 points. In each point it was evaluated the total volume of porosity, macroporosity, microporosity, bulk density, soil penetration resistance and soil water content. The studied attributes in the pasture area present indicator of soil compaction for the animals' traffic, with moderate and strong structure of spatial dependence, except for the macroporosity and penetration resistance. In the area of secondary vegetation (VN) only the macroporosity does not present spatial dependence. The total volume of porosity and the bulk density present the same spatial standard in the area under pasture.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
This study evaluated in vitro the pulp chamber temperature rise induced by the light-activated dental bleaching technique using different light sources. The root portions of 78 extracted sound human mandibular incisors were sectioned approximately 2 mm below the cementoenamel junction. The root cavities of the crowns were enlarged to facilitate the correct placing of the sensor into the pulp chamber. Half of specimens (n=39) was assigned to receive a 35% hydrogen peroxide gel on the buccal surface and the other halt (n=39) not to receive the bleaching agent. Three groups (n=13) were formed for each condition (bleach or no bleach) according to the use of 3 light sources recommended for dental bleaching: a light-emitting diode (LED)laser system, a LED unit and a conventional halogen light. The light sources were positioned perpendicular to the buccal surface at a distance of 5 mm and activated during 30 s. The differences between the initial and the highest temperature readings for each specimen were obtained, and, from the temperature changes, the means for each specimen and each group were calculated. The values of temperature rise were compared using Kruskal-Wallis test at 1% significance level. Temperature rise varied significantly depending on the light-curing unit, with statistically significant differences (p<0.01) among the groups. When the bleaching agent was not applied, the halogen light induced the highest temperature rise (2.38±0.66ºC). The LED unit produced the lowest temperature increase (0.29±0.13ºC); but there was no significant difference between LED unit and LED-laser system (0.35±0.15ºC) (p>0.01). When the bleaching agent was applied, there were significant differences among groups (p<0.01): halogen light induced the highest temperature rise (1.41±0.64ºC), and LED-laser system the lowest (0.33±0.12ºC); however, there was no difference between LED-laser system and LED unit (0.44±0.11ºC). LED and LED-laser system did not differ significantly from each other regardless the temperature rise occurred with or without bleaching agent application. It may be concluded that during light-activated tooth bleaching, with or without the bleaching agent, halogen light promoted higher pulp chamber temperature rise than LED unit and LED-laser system. The tested light-curing units provided increases in the pulp chamber temperature that were compatible with pulpal health.
Resumo:
This ex vivo study evaluated dentin permeability of the root canal in the apical third of different human groups of teeth. Eighty teeth were used, 8 from each dental group: maxillary and mandibular central incisors, lateral incisors and canines, maxillary first premolars (buccal and palatal roots), mandibular first premolars, and maxillary and mandibular second premolars, totalizing 88 roots that were distributed in 11 groups. The root canals were instrumented, irrigated with 1% NaOCl and 15% EDTA. Roots were immersed in 10% copper sulfate for 30 min and then in 1% rubeanic acid alcohol solution for the same period; this chemical reaction reveals dentin permeability by the formation of copper rubeanate, which is a dark-colored compound. Semi-serial 100-µm-thick cross-sections were obtained from the apical third of the roots. Five sections of each apical third were washed, dehydrated, cleared and mounted on glass slides for examination under optical microscopy. The percentage of copper ion infiltration and the amount of tubular dentin were quantified by morphometric analysis. The penetration of copper ions in the apical third ranged from 4.60 to 16.66%. The mandibular central and lateral incisors presented the highest dentin permeability (16.66%), while the maxillary canines and mandibular second and first premolars presented the lowest dentin permeability (4.60%, 4.80% and 5.71%, respectively; p<0.001). The other teeth presented intermediate permeability. In conclusion, dye penetration into dentin tubules at the apical region is strongly dependent on the group of teeth evaluated.
Resumo:
OBJECTIVE: To assess microleakage in conservative class V cavities prepared with aluminum-oxide air abrasion or turbine and restored with self-etching or etch-and-rinse adhesive systems. Materials and Methods: Forty premolars were randomly assigned to 4 groups (I and II: air abrasion; III and IV: turbine) and class V cavities were prepared on the buccal surfaces. Conditioning approaches were: groups I/III - 37% phosphoric acid; groups II/IV - self-priming etchant (Tyrian-SPE). Cavities were restored with One Step Plus/Filtek Z250. After finishing, specimens were thermocycled, immersed in 50% silver nitrate, and serially sectioned. Microleakage at the occlusal and cervical interfaces was measured in mm and calculated by a software. Data were subjected to ANOVA and Tukey's test (α=0.05). RESULTS: Marginal seal provided by air abrasion was similar to high-speed handpiece, except for group I. There was SIGNIFICANT difference between enamel and dentin/cementum margins for to group I and II: air abrasion. The etch-and-rinse adhesive system promoted a better marginal seal. At enamel and dentin/cementum margins, the highest microleakage values were found in cavities treated with the self-etching adhesive system. At dentin/cementum margins, high-speed handpiece preparations associated with etch-and-rinse system provided the least dye penetration. CONCLUSION: Marginal seal of cavities prepared with aluminum-oxide air abrasion was different from that of conventionally prepared cavities, and the etch-and-rinse system promoted higher marginal seal at both enamel and dentin margins.