Platinum Blue Staining Of Cells Grown In Electrospun Scaffolds.

Fibroblast cells grown in electrospun polymer scaffolds were stained with platinum blue, a heavy metal stain, and imaged using scanning electron microscopy. Good contrast on the cells was achieved compared with samples that were gold sputter coated. The cell morphology could be clearly observed, and the cells could be distinguished from the scaffold fibers. Here we optimized the required concentration of platinum blue for imaging cells grown in scaffolds and show that a higher concentration causes platinum aggregation. Overall, platinum blue is a useful stain for imaging cells because of its enhanced contrast using scanning electron microscopy (SEM). In the future it would be useful to investigate cell growth and morphology using three-dimensional imaging methods.

Elevated Cetp Activity During Acute Phase Of Myocardial Infarction Is Independently Associated With Endothelial Dysfunction And Adverse Clinical Outcome.

Recent data suggests that cholesteryl ester transfer protein (CETP) activity may interact with acute stress conditions via inflammatory-oxidative response and thrombogenesis. We investigated this assumption in patients with ST-elevation myocardial infarction (STEMI). Consecutive patients with STEMI (n = 116) were enrolled <24-h of symptoms onset and were followed for 180 days. Plasma levels of C-reactive protein (CRP), interleukin-2 (IL-2), tumor necrosis factor (TNFα), 8-isoprostane, nitric oxide (NOx) and CETP activity were measured at enrollment (D1) and at fifth day (D5). Flow-mediated dilation (FMD) was assessed by ultrasound and coronary thrombus burden (CTB) was evaluated by angiography. Neither baseline nor the change of CETP activity from D1 to D5 was associated with CRP, IL-2, TNFα, 8-isoprostane levels or CTB. The rise in NOx from D1 to D5 was inferior [3.5(-1; 10) vs. 5.5(-1; 12); p < 0.001] and FMD was lower [5.9(5.5) vs. 9.6(6.6); p = 0.047] in patients with baseline CETP activity above the median value than in their counterparts. Oxidized HDL was measured by thiobarbituric acid reactive substances (TBARS) in isolated HDL particles and increased from D1 to D5, and remaining elevated at D30. The change in TBARS content in HDL was associated with CETP activity (r = 0.72; p = 0.014) and FMD (r = -0.61; p = 0.046). High CETP activity at admission was associated with the incidence of sudden death and recurrent MI at 30 days (OR 12.8; 95% CI 1.25-132; p = 0.032) and 180 days (OR 3.3; 95% CI 1.03-10.7; p = 0.044). An enhanced CETP activity during acute phase of STEMI is independently associated with endothelial dysfunction and adverse clinical outcome.

Evaluation Of The Location Of Capsules Swallowed With Food During The Pharyngeal Phase Triggering In Asymptomatic Adults.

To assess the location of hard gelatin capsules in the pharyngeal phase triggering among asymptomatic adults. The location of the bolus during the pharyngeal phase triggering provides information about the sensorimotor model of the beginning of deglutition onset. To evaluate the location of hard gelatin capsules in the pharyngeal phase triggering among asymptomatic adults. A videofluoroscopy swallowing study was carried out in 60 subjects (14 male and 46 female participants) aged between 27 and 55 years, who were evaluated with hard gelatin capsules #00 and #3 containing barium sulfate, swallowed with liquid food and pudding, in free volume. The first laryngeal elevation movement was the criterion to locate the pharyngeal phase triggering. Statistical analysis was based on the McNemar test. Capsule #3 presented higher percentage of location in the tongue dorsum compared to capsule #00, and capsule #00 presented higher percentage of location in the tongue base and vallecula compared to capsule #3. There was a difference between different capsules swallowed with liquid (p=0.016) and pudding (p=0.037). The capsule size influenced the location of the pharyngeal phase triggering. Smaller capsules started pharyngeal phase in the most anterior region (tongue dorsum) compared to larger capsules.

Transition From Glass To Digital Slide Microscopy In The Teaching Of Oral Pathology In A Brazilian Dental School.

Several medical and dental schools have described their experience in the transition from conventional to digital microscopy in the teaching of general pathology and histology disciplines; however, this transitional process has scarcely been reported in the teaching of oral pathology. Therefore, the objective of the current study is to report the transition from conventional glass slide to virtual microscopy in oral pathology teaching, a unique experience in Latin America. An Aperio ScanScope® scanner was used to digitalize histological slides used in practical lectures of oral pathology. The challenges and benefits observed by the group of Professors from the Piracicaba Dental School (Brazil) are described and a questionnaire to evaluate the students' compliance to this new methodology was applied. An improvement in the classes was described by the Professors who mainly dealt with questions related to pathological changes instead of technical problems; also, a higher interaction with the students was described. The simplicity of the software used and the high quality of the virtual slides, requiring a smaller time to identify microscopic structures, were considered important for a better teaching process. Virtual microscopy used to teach oral pathology represents a useful educational methodology, with an excellent compliance of the dental students.

Breaking Oil-in-water Emulsions Stabilized By Yeast.

Several biotechnological processes can show an undesirable formation of emulsions making difficult phase separation and product recovery. The breakup of oil-in-water emulsions stabilized by yeast was studied using different physical and chemical methods. These emulsions were composed by deionized water, hexadecane and commercial yeast (Saccharomyces cerevisiae). The stability of the emulsions was evaluated varying the yeast concentration from 7.47 to 22.11% (w/w) and the phases obtained after gravity separation were evaluated on chemical composition, droplet size distribution, rheological behavior and optical microscopy. The cream phase showed kinetic stability attributed to mechanisms as electrostatic repulsion between the droplets, a possible Pickering-type stabilization and the viscoelastic properties of the concentrated emulsion. Oil recovery from cream phase was performed using gravity separation, centrifugation, heating and addition of demulsifier agents (alcohols and magnetic nanoparticles). Long centrifugation time and high centrifugal forces (2h/150,000×g) were necessary to obtain a complete oil recovery. The heat treatment (60°C) was not enough to promote a satisfactory oil separation. Addition of alcohols followed by centrifugation enhanced oil recovery: butanol addition allowed almost complete phase separation of the emulsion while ethanol addition resulted in 84% of oil recovery. Implementation of this method, however, would require additional steps for solvent separation. Addition of charged magnetic nanoparticles was effective by interacting electrostatically with the interface, resulting in emulsion destabilization under a magnetic field. This method reached almost 96% of oil recovery and it was potentially advantageous since no additional steps might be necessary for further purifying the recovered oil.

Effect Of Calendula Officinalis Cream On Achilles Tendon Healing.

In recent years, the scientific community has undertaken research on plant extracts, searching for compounds with pharmacological activities that can be used in diverse fields of medicine. Calendula officinalis L. is known to have antioxidant, anti-inflammatory, antibacterial, and wound healing properties when used to treat skin burns. Therefore, the purpose of this study was to analyze the effects of C. officinalis on the initial phase of Achilles tendon healing. Wistar rats were separated in three groups: Calendula (Cal)-rats with a transected tendon were treated with topical applications of C. officinalis cream and then euthanized 7 days after injury; Control (C)-rats were treated with only vehicle after transection; and Normal (N)-rats without tenotomy. Higher concentrations of hydroxyproline (an indicator of total collagen) and non-collagenous proteins were observed in the Cal group in relation to the C group. Zymography showed no difference in the amount of the isoforms of metalloproteinase-2 and of metalloproteinase-9, between C and Cal groups. Polarization microscopy images analysis showed that the Cal group presented a slightly higher birefringence compared with the C group. In sections of tendons stained with toluidine blue, the transected groups presented higher metachromasy as compared with the N group. Immunocytochemistry analysis for chondroitin-6-sulfate showed no difference between the C and Cal groups. In conclusion, the topical application of C. officinalis after tendon transection increases the concentrations of collagen and non-collagenous proteins, as well as the collagen organization in the initial phase of healing.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Modelo para análise do ataque no futebol = : A model to analyze soccer offensive phase

Universidade Estadual de Campinas . Faculdade de Educação Física

Análise do desempenho em testes de triathlon com diferentes intensidades durante a etapa natação = : Analysis of triathlon trials performance using different intensities during swimming phase

Universidade Estadual de Campinas . Faculdade de Educação Física

Scanning electron microscopic study of the in situ effect of salivary stimulation on erosion and abrasion in human and bovine enamel

This in situ study investigated, using scanning electron microscopy, the effect of stimulated saliva on the enamel surface of bovine and human substrates submitted to erosion followed by brushing abrasion immediately or after one hour. During 2 experimental 7-day crossover phases, 9 previously selected volunteers wore intraoral palatal devices, with 12 enamel specimens (6 human and 6 bovine). In the first phase, the volunteers immersed the device for 5 minutes in 150 ml of a cola drink, 4 times a day (8h00, 12h00, 16h00 and 20h00). Immediately after the immersions, no treatment was performed in 4 specimens (ERO), 4 other specimens were immediately brushed (0 min) using a fluoride dentifrice and the device was replaced into the mouth. After 60 min, the other 4 specimens were brushed. In the second phase, the procedures were repeated but, after the immersions, the volunteers stimulated the salivary flow rate by chewing a sugar-free gum for 30 min. Enamel superficial alterations of all specimens were then evaluated using a scanning electron microscope. Enamel prism core dissolution was seen on the surfaces submitted to erosion, while on those submitted to erosion and to abrasion (both at 0 and 60 min) a more homogeneous enamel surface was observed, probably due to the removal of the altered superficial prism layer. For all the other variables - enamel substrate and salivary stimulation -, the microscopic pattern of the enamel specimens was similar.

Comparison among four commonly used demineralizing agents for root conditioning: a scanning electron microscopy

Dental roots that have been exposed to the oral cavity and periodontal pocket environment present superficial changes, which can prevent connective tissue reattachment. Demineralizing agents have been used as an adjunct to the periodontal treatment aiming at restoring the biocompatibility of roots. OBJECTIVE: This study compared four commonly used demineralizing agents for their capacity of removing smear layer and opening dentin tubules. METHODS: Fifty fragments of human dental roots previously exposed to periodontal disease were scaled and randomly divided into the following groups of treatment: 1) CA: demineralization with citric acid for 3 min; 2) TC-HCl: demineralization with tetracycline-HCl for 3 min; 3) EDTA: demineralization with EDTA for 3 min; 4) PA: demineralization with 37% phosphoric acid for 3 min; 5) Control: rubbing of saline solution for 3 min. Scanning electron microscopy was used to check for the presence of residual smear layer and for measuring the number and area of exposed dentin tubules. RESULTS: Smear layer was present in 100% of the specimens from the groups PA and control; in 80% from EDTA group; in 33.3% from TC-HCl group and 0% from CA group. The mean numbers of exposed dentin tubules in a standardized area were: TC-HCl=43.8±25.2; CA=39.3±37; PA=12.1±16.3; EDTA=4.4±7.5 and Control=2.3±5.7. The comparison showed significant differences between the following pairs of groups: TC-HCl and Control; TC-HCl and EDTA; CA and Control; and CA and EDTA. The mean percentages of area occupied by exposed dentin tubules were: CA=0.12±0.17%; TC-HCl=0.08±0.06%; PA=0.03±0.05%; EDTA=0.01±0.01% and Control=0±0%. The CA group differed significantly from the others except for the TC-HCl group. CONCLUSION: There was a decreasing ability for smear layer removal and dentin tubule widening as follows: AC>TC-HCl>PA>EDTA. This information can be of value as an extra parameter for choosing one of them for root conditioning.

Morfologia e funcionalidade do pneumócito tipo II e sua relação e variação com a idade gestacional em bovinos

Este estudo objetivou caracterizar a presença de pneumócitos tipo II e o início da produção de lipoproteína surfactante em bovinos, correlacionando a idade gestacional com a síntese de surfactante durante o desenvolvimento fetal. Pulmões de fetos com quatro meses de idade gestacional estavam na fase canalicular de desenvolvimento, sem a presença de pneumócitos tipo II ou bandas eletroforéticas compatíveis com a presença de proteínas surfactante. No 5° mês gestacional, os pulmões dos fetos encontravam-se em fase de saculação terminal, com a presença de alvéolos por epitélio cúbico, com áreas formadas por pneumócitos I e II. Nesse período ainda não foi possível identificar proteína surfactante nos pulmões. Esses órgãos em fetos com seis meses de idade gestacional estavam em fase de saco terminal, com presença de pneumócitos tipo I e II. Nessa fase a análise para determinação protéica do surfactante de feto bovino (SDS - PAGE) demonstrou presença de bandas entre 26 e 36kDa, confirmando produção de SP - A, proteína surfactante encontrada em maior quantidade. A partir do 7° mês gestacional, a fase de saco terminal é mais evidente e complexa, com desenvolvimento de intensa vascularização. O pneumócito tipo I apresentava aspecto mais pavimentoso, e o tipo II apresentava aspecto mais globoso. Na análise SDS - PAGE do lavado bronco - alveolar, bandas de proteína surfactante com aspecto similar ao de animais recém-nascidos foram encontradas. Em recém-nascidos, pulmões na fase alveolar foram observados com pneumócitos tipo I e II característicos. O perfil das bandas do lavado bronco-alveolar dos recém-nascidos foi igual ao de animais adultos. Esses achados sugerem que um animal nascido precocemente, a partir dos sete meses de gestação, teria sua sobrevivência garantida devido a uma possível funcionalidade do sistema respiratório do feto, pois o pulmão possuiria as características necessárias para a síntese de proteínas surfactantes. Entretanto, mais estudos clínicos sobre a funcionalidade do sistema respiratório abrem novas fronteiras de experimentos sobre fisiologia respiratória em recém-nascidos bovinos.

Phase transitions in biodegradable films based on blends of gelatin and poly (vinyl alcohol)

The aim of this work was to study the effect of the hydrolysis degree (HD) and the concentration (C PVA) of two types of poly (vinyl alcohol) (PVA) and the effect of the type and the concentration of plasticizers on the phase properties of biodegradable films based on blends of gelatin and PVA, using a response-surface methodology. The films were made by casting and the studied properties were their glass (Tg) and melting (Tm) transition temperatures, which were determined by diferential scanning calorimetry (DSC). For the data obtained on the first scan, the fitting of the linear model was statistically significant and predictive only for the second melting temperature. In this case, the most important effect on the second Tm of the first scan was due to the HD of the PVA. In relation to the second scan, the linear model could be fit to Tg data with only two statistically significant parameters. Both the PVA and plasticizer concentrations had an important effect on Tg. Concerning the second Tm of the second scan, the linear model was fit to data with two statistically significant parameters, namely the HD and the plasticizer concentration. But, the most important effect was provoked by the HD of the PVA.

Análise morfológica e fisiológica dos fígados e rins de ratas prenhes e seus fetos tratados pela associação zidovudina, lamivudina e ritonavir durante toda a prenhez

OBJETIVO: avaliar os efeitos da administração da associação zidovudina-lamivudina-ritonavir nos fígados e rins de ratas prenhes e seus conceptos do ponto de vista morfológico e fisiológico. MÉTODOS: 40 ratas albinas prenhes foram aleatoriamente divididas em 4 grupos: 1 controle (Ctrl: controle de veículo) e 3 experimentais (Exp1x, Exp3x e Exp9x). Estes últimos foram tratados por solução oral de zidovudina/lamivudina/ritonavir (Exp1x: 10/5/20 mg/kg; Exp3x: 30/15/60 mg/kg; Exp9x: 90/45/180 mg/kg). As drogas e o veículo foram administrados por gavagem, desde o 1º até o 20º dia de prenhez. No último dia do experimento, todos os animais foram anestesiados e sangue foi retirado da cavidade cardíaca para avaliação sérica das enzimas aspartato aminotransferase (AST) e alanina aminotransferase (ALT), por método calorimétrico, bem como da ureia, determinada por método cinético-enzimático, e creatinina, por método cinético-colorimétrico. Em seguida, fragmentos dos fígados e rins maternos e fetais foram coletados, fixados em formol a 10% e processados segundo os métodos histológicos para inclusão em parafina. Cortes com 5 µm de espessura foram corados pela hematoxilina-eosina (HE) e analisados por microscopia de luz. Na leitura das lâminas, considerou-se o padrão de normalidade para fígado e rins, tais como: hepatócitos, espaço porta íntegros e veias hepáticas bem definidas. Nos rins, a presença de corpúsculos renais, túbulos contorcidos e alças de Henle típicos. Nos fígados fetais considerou-se, ainda, a morfologia das células da linhagem eritrocitária nas diferentes fases do desenvolvimento, bem como os megacariócitos. Quando houve alteração da coloração padrão estabelecida para as estruturas hepáticas e renais, alteração na morfologia de núcleos, rompimento de limites de alguma organela citoplasmática, presença de congestão vascular, tudo isso foi entendido como provavelmente provocado pelas drogas em sua(s) dose(s) de aplicação. A avaliação estatística foi realizada por análise de variância (ANOVA), completada pelo teste de Tukey-Kramer (p<0,05). RESULTADOS: os fígados maternos dos grupos Ctrl, Exp1x e Exp3x mostraram hepatócitos típicos, espaço porta íntegros e veias hepáticas com aspecto normal. No fígado materno do grupo Exp9x, foram encontrados hepatócitos com sinais de atrofia e apoptose (eosinofilia citoplasmática e núcleos picnóticos). Além disso, identificou-se vasodilatação dos capilares sinusoides (congestão). Os rins maternos dos grupos Ctrl e Exp1x apresentaram-se normais, com corpúsculos renais, túbulos contorcidos e alças de Henle típicos. Já nos grupos Exp3x e Exp9x, foram encontrados congestão vascular, glomérulos pequenos ricos em células contendo núcleos hipercromáticos, sendo mais intensos no Exp9x. Com relação aos fígados e rins fetais, não foram observadas alterações morfológicas ou fisiológicas nos grupos estudados. Encontrou-se aumento significante nos níveis da AST (305,70±55,80; p<0,05) e da creatinina (0,50±0,09; p<0,05) no grupo Exp9x. CONCLUSÕES: nossos resultados evidenciam que a administração da associação zidovudina/lamivudina/ritonavir a ratas prenhes em altas doses causa alterações morfológicas e funcionais nos fígados e rins maternos. Não houve alterações nem morfológicas nem fisiológicas nos fígados e rins fetais.

The anticancer drug tamoxifen is active against Trypanosoma cruzi in vitro but ineffective in the treatment of the acute phase of Chagas disease in mice

The activity of the antineoplastic drug tamoxifen was evaluated against Trypanosoma cruzi. In vitro activity was determined against epimastigote, trypomastigote and amastigote forms of CL14, Y and Y benznidazole resistant T. cruzi strains. Regardless of the strain used, the drug was active against all life-cycle stages of the parasite with a half maximal effective concentration ranging from 0.7-17.9 µM. Two experimental models of acute Chagas disease were used to evaluate the in vivo efficacy of treatment with tamoxifen. No differences in parasitemia and mortality were observed between control mock-treated and tamoxifen-treated mice.