Annotated record of the detailed examination of Mn deposits from SOUTHTOW Expedition stations (R/V Thomas Washington)

The cores described in this report were taken on the SOUTHTOW Expedition in June 1972 to January 1973 by the Scripps Institution of Oceanography from the R/V Thomas Washington. A total of 105 cores and dredges were recovered and are available at Scripps for sampling and study.

(Table 2) Radiocarbon dates from lakes on Fildes Peninsula, King George Island

Precise relative sea level (RSL) data are important for inferring regional ice sheet histories, as well as helping to validate numerical models of ice sheet evolution and glacial isostatic adjustment. Here we develop a new RSL curve for Fildes Peninsula, South Shetland Islands (SSIs), a sub-Antarctic archipelago peripheral to the northern Antarctic Peninsula ice sheet, by integrating sedimentary evidence from isolation basins with geomorphological evidence from raised beaches. This combined approach yields not only a Holocene RSL curve, but also the spatial pattern of how RSL change varied across the archipelago. The curve shows a mid-Holocene RSL highstand on Fildes Peninsula at 15.5 m above mean sea level between 8000 and 7000 cal a BP. Subsequently RSL gradually fell as a consequence of isostatic uplift in response to regional deglaciation. We propose that isostatic uplift occurred at a non-steady rate, with a temporary pause in ice retreat ca. 7200 cal a BP, leading to a short-lived RSL rise of ~1 m and forming a second peak to the mid-Holocene highstand. Two independent approaches were taken to constrain the long-term tectonic uplift rate of the SSIs at 0.22-0.48 m/ka, placing the tectonic contribution to the reconstructed RSL highstand between 1.4 and 2.9 m. Finally, we make comparisons to predictions from three global sea level models.

At surface behaviour of juvenile and female southern elephant seals from King George Island from expeditions JUB1996 and JUB1997

Between December 1996 and February 1997, weaned pups and postmoult female southern elephant seals (Mirounga leonina) were fitted with satellite transmitters at King George Island (South Shetlands). Of the nine adult females tracked for more than two months, three stayed in a localized area between the South Shetlands and the South Orkneys. The other six females travelled southwest along the coast of the Antarctic Peninsula up to the Bellingshausen Sea. Two of them then moved far northeast and hauled out on South Georgia in October. One female was last located north of the South Shetlands in March 1998. In total, eight females were again sighted on King George Island and six of the transmitters removed. The tracks of the weaners contrasted with those of the adults. In January, five juveniles left King George Island for the Pacific sector ranging about four weeks in the open sea west of the De Gerlache Seamounts. Three of them returned to the tip of the Antarctic Peninsula in June, of which one was last located on the Patagonian Shelf in November 1997. A computer animation was developed to visualize the animal movements in relation to the extent and concentration of sea ice. The juveniles avoided sea ice while the adults did not. The latter displayed behavioural differences in using the pack ice habitat during winter. Some females adjusted their movement patterns to the pulsating sea ice fringe in far-distant foraging areas while others ranged in closed pack ice of up to 100 %. The feeding grounds of adult female elephant seals are more closely associated with the pack ice zone than previously assumed.

Select Document: Sir George Radcliffe’s “Original of Government” (1639) and Absolutist Political Theory in Stuart Ireland

A seventeenth-century manuscript miscellany, which once belonged to Archbishop James Ussher of Armagh, contains a short treatise on the origins of government by Sir George Radcliffe. Radcliffe was legal assistant to Sir Thomas Wentworth, lord deputy of Ireland (from January 1640 earl of Strafford and lord lieutenant). The treatise insisted on the divine origin of all human political power and implied that the best form of government was absolute monarchy, in which the monarch was free of all human law and subject to divine restraint alone. It will be suggested below that the composition of this treatise can be dated to the summer of 1639. This introduction will offer an outline of Radcliffe’s education and political career, explain the genesis of his treatise on government, point out some pertinent aspects of its argument, and finally assess the document’s significance.

Annaes do Parlamento Brazileiro. Tomo II [1830]

Anais do Parlamento Brasileiro, 1830.

Annaes do Parlamento Brazileiro. Tomo I [1830]

Anais do Parlamento Brasileiro, 1830.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Thaptomys Thomas 1915 (Rodentia, Sigmodontinae, Akodontini) with karyotypes 2n = 50, FN = 48, and 2n = 52, FN = 52: two monophyletic lineages recovered by molecular phylogeny

A novel karyotype with 2n = 50, FN = 48, was described for specimens of Thaptomys collected at Una, State of Bahia, Brazil, which are morphologically indistinguishable from Thaptomys nigrita, 2n = 52, FN = 52, found in other localities. It was hence proposed that the 2n = 50 karyotype could belong to a distinct species, cryptic of Thaptomys nigrita, once chromosomal rearrangements observed, along with the geographic distance, might represent a reproductive barrier between both forms. Phylogenetic analyses using maximum parsimony and maximum likelihood based on partial cytochrome b sequences with 1077 bp were performed, attempting to establish the relationships among the individuals with distinct karyotypes along the geographic distribution of the genus; the sample comprised 18 karyotyped specimens of Thaptomys, encompassing 15 haplotypes, from eight different localities of the Atlantic Rainforest. The intra-generic relationships corroborated the distinct diploid numbers, once both phylogenetic reconstructions recovered two monophyletic lineages, a northeastern clade grouping the 2n = 50 and a southeastern clade with three subclades, grouping the 2n = 52 karyotype. The sequence divergence observed between their individuals ranged from 1.9% to 3.5%.

Kelp gulls, Larus dominicanus (Aves: Laridae), breeding in Keller Peninsula, King George Island, Antarctic Peninsula

We examined the distribution, abundance and density of the Kelp Gull, Larus dominicanus (Lichtenstein, 1823), at Keller Peninsula on two occasions during the breeding season of 2007-2008 (once for incubation and once for chick stages) and compared our results with previously published data. We present information on the number of eggs, incubation success, and initial development of L. dominicanus chicks in the studied sites. The abundance and density of the species has remained statistically similar in Keller Peninsula over the last 30 years (since 1978-1979). Although the abundance and density were almost unchanged, we recorded alterations in the occupation of the breeding areas by L. dominicanus, mainly the abandonment of breeding sites in the eastern portion of Keller Peninsula. The results of the present study compared with similar previous investigations on the abundance of L. dominicanus indicate that the populations have been in equilibrium over the years.

Description of the pupal case of Systropus (Systropus) nitidus Wiedemann, 1830 (Diptera, Bombyliidae, Toxophorinae, Systropodini)

The pupal case of Systropus (Systropus) nitidus Wiedemann reared from an unidentified tipical Limacodidae (Lepidoptera) cocoon is described and illustrated for the first time. Only species of Limacodidae are recorded as host of the immature stages of S. (Systropus). The geographical distribution of S. (Systropus) nitidus is restricted to Brazil, from Pará to Santa Catarina states. This is the first pupal case description and illustration of a Neotropical species of the subgenus Systropus.

A phylogenetic study of the subtribe Dicrepidiina (Elateridae, Elaterinae, Ampedini)

It is presented a cladistic analysis of the Dicrepidiina aiming to test the monophyletism of the subtribe and to establish the relationships among the genera. The subtribe is composed by 36 genera and all of them, except Asebis, Lamononia, Neopsephus, Semiotopsis and Spilomorphus were included in the analysis. Fifty two species, especially the type-species of each genus were studied: Achrestus flavocinctus (Candèze, 1859), A. venustus Champion, 1895, Adiaphorus gracilis Schwarz, 1901, A. ponticerianus Candèze, 1859, Anoplischiopsis bivittatus Champion, 1895, Anoplischius bicarinatus Candèze, 1859, A. conicus Candèze, 1900, A. haematopus Candèze, 1859, A. pyronotus Candèze, 1859, Atractosomus flavescens (Germar, 1839), Blauta cribraria (Germar, 1844), Calopsephus apicalis (Schwarz, 1903), Catalamprus angustus (Fleutiaux, 1902), Crepidius flabellifer (Erichson, 1847), C. resectus Candèze, 1859, Cyathodera auripilosus Costa, 1968, C. lanugicollis (Candèze, 1859), C. longicornis Blanchard, 1843, Dayakus angularis Candèze, 1893, Dicrepidius ramicornis (Palisot de Beauvois, 1805), Dipropus brasilianus (Germar, 1824), D. factuellus Candèze, 1859, D. laticollis (Eschscholtz, 1829), D. pinguis (Candèze, 1859), D. schwarzi (Becker, 1961), Elius birmanicus Candèze, 1893, E. dilatatus Candèze, 1878, Heterocrepidius gilvellus Candèze, 1859, H. ventralis Guérin-Méneville, 1838, Lampropsephus cyaneus (Candèze, 1878), Loboederus appendiculatus (Perty, 1830), Olophoeus gibbus Candèze, 1859, Ovipalpus pubescens Solier, 1851, Pantolamprus ligneus Candèze, 1896, P. mirabilis Candèze, 1896, P. perpulcher Westwood, 1842, Paraloboderus glaber Golbach, 1990, Proloboderus crassipes Fleutiaux, 1912, Propsephus beniensis (Candèze, 1859), P. cavifrons (Erichson, 1843), Pseudolophoeus guineensis (Candèze, 1881), Rhinopsephus apicalis (Schwarz, 1903), Sephilus formosanus Schwarz, 1912, S. frontalis Candèze, 1878, Singhalenus gibbus Candèze, 1892, S. taprobanicus Candèze, 1859, Sphenomerus antennalis Candèze, 1859, S. brunneus Candèze, 1865, Spilus atractomorphus Candèze, 1859, S. nitidus Candèze, 1859, Stenocrepidius simonii Fleutiaux, 1891 and Trielasmus varians Blanchard, 1846. Chalcolepidius zonatus (Hemirhipini, Agrypninae), Ctenicera silvatica (Prosternini, Prosterninae), and species of the other subtribes of Ampedini (Elaterinae): Ampedus sanguineus (Ampedina), Melanotus spernendus (Melanotina) and Anchastus digittatus and Physorhinus xanthocephalus (Physorhinina) were used as outgroups. The results of the phylogenetic analysis demonstrated that Dicrepidiina, as formerly defined, does not form a monophyletic group. One genus, represented by Ovipalpus pubescens, was removed from the subtribe. The subtribe is characterized by presence of lamella under 2nd and 3rd tarsomeres of all legs. Also, it was revealed that the genera Achrestus, Anoplischius, Dipropus and Propsephus are not monophyletic. Due to the scarcity of information, all the studied species are redescribed and illustrated.

Cytogenetic analysis of Astylus antis (Perty, 1830) (Coleoptera, Melyridae): Karyotype, heterochromatin and location of ribosomal genes

Cytogenetic analysis of Astylus antis using mitotic and meiotic cells was performed to characterize the haploid and diploid numbers, sex determination system, chromosome morphology, constitutive heterochromatin distribution pattern and chromosomes carrying nucleolus organizer regions (NORs). Analysis of spermatogonial metaphase cells revealed the diploid number 2n = 18, with mostly metacentric chromosomes. Metaphase I cells exhibited 2n = 8II+Xyp and a parachute configuration of the sex chromosomes. Spermatogonial metaphase cells submitted to C-banding showed the presence of small dots of constitutive heterochromatin in the centromeric regions of nearly all the autosomes and on the short arm of the X chromosome (Xp), as well as an additional band on one of the arms of pair 1. Mitotic cells submitted to double staining with base-specific fluorochromes (DAPI-CMA3) revealed no regions rich in A+T or G+C sequences. Analysis of spermatogonial mitotic cells after sequential Giemsa/AgNO3 staining did not reveal any specific mark on the chromosomes. Meiotic metaphase I cells stained with silver nitrate revealed a strong impregnation associated to the sex chromosomes, and in situ hybridization with an 18S rDNA probe showed ribosomal cistrons in an autosomal bivalent.

Study of infection by Rickettsiae of the spotted fever group in humans and ticks in an urban park located in the City of Londrina, State of Paraná, Brazil

INTRODUCTION: Spotted fevers are emerging zoonoses caused by Rickettsia species in the spotted fever group (SFG). Rickettsia rickettsii is the main etiologic agent of Brazilian spotted fever (BSF) and it is transmitted by Amblyomma spp. ticks. METHODS: The study aimed to investigate SFG rickettsiae in the Arthur Thomas Municipal Park in Londrina, PR, by collecting free-living ticks and ticks from capybaras and blood samples from personnel working in these areas. Samples from A. dubitatum and A. cajennense were submitted for PCR in pools to analyze the Rickettsia spp. gltA (citrate synthase gene). RESULTS: All the pools analyzed were negative. Human sera were tested by indirect immunofluorescence assay with R. rickettsii and R. parkeri as antigens. Among the 34 sera analyzed, seven (20.6%) were reactive for R. rickettsii: four of these had endpoint titers equal to 64, 2 titers were 128 and 1 titer was 256. None of the samples were reactive for R. parkeri. An epidemiological questionnaire was applied to the park staff, but no statistically significant associations were identified. CONCLUSIONS: The serological studies suggest the presence of Rickettsiae related to SFG that could be infecting the human population studied; however, analysis of the ticks collected was unable to determine which species may be involved in transmission to humans.

Working at night and work ability among nursing personnel: when precarious employment makes the diVerence

Purpose To test the association between night work and work ability, and verify whether the type of contractual employment has any inXuence over this association. Methods Permanent workers (N = 642) and workers with precarious jobs (temporary contract or outsourced; N = 552) were interviewed and Wlled out questionnaires concerning work hours and work ability index. They were classiWed into: never worked at night, ex-night workers, currently working up to Wve nights, and currently working at least six nights/2-week span. Results After adjusting for socio-demography and work variables, current night work was signiWcantly associated with inadequate WAI (vs. day work with no experience in night work) only for precarious workers (OR 2.00, CI 1.01- 3.95 and OR 1.85, CI 1.09-3.13 for those working up to Wve nights and those working at least six nights in 2 weeks, respectively). Conclusions Unequal opportunities at work and little experience in night work among precarious workers may explain their higher susceptibility to night work