Apoplastic And Intracellular Plant Sugars Regulate Developmental Transitions In Witches' Broom Disease Of Cacao.

Witches' broom disease (WBD) of cacao differs from other typical hemibiotrophic plant diseases by its unusually long biotrophic phase. Plant carbon sources have been proposed to regulate WBD developmental transitions; however, nothing is known about their availability at the plant-fungus interface, the apoplastic fluid of cacao. Data are provided supporting a role for the dynamics of soluble carbon in the apoplastic fluid in prompting the end of the biotrophic phase of infection. Carbon depletion and the consequent fungal sensing of starvation were identified as key signalling factors at the apoplast. MpNEP2, a fungal effector of host necrosis, was found to be up-regulated in an autophagic-like response to carbon starvation in vitro. In addition, the in vivo artificial manipulation of carbon availability in the apoplastic fluid considerably modulated both its expression and plant necrosis rate. Strikingly, infected cacao tissues accumulated intracellular hexoses, and showed stunted photosynthesis and the up-regulation of senescence markers immediately prior to the transition to the necrotrophic phase. These opposite findings of carbon depletion and accumulation in different host cell compartments are discussed within the frame of WBD development. A model is suggested to explain phase transition as a synergic outcome of fungal-related factors released upon sensing of extracellular carbon starvation, and an early senescence of infected tissues probably triggered by intracellular sugar accumulation.

Low-level Laser Therapy To The Mouse Femur Enhances The Fungicidal Response Of Neutrophils Against Paracoccidioides Brasiliensis.

Neutrophils (PMN) play a central role in host defense against the neglected fungal infection paracoccidioidomycosis (PCM), which is caused by the dimorphic fungus Paracoccidioides brasiliensis (Pb). PCM is of major importance, especially in Latin America, and its treatment relies on the use of antifungal drugs. However, the course of treatment is lengthy, leading to side effects and even development of fungal resistance. The goal of the study was to use low-level laser therapy (LLLT) to stimulate PMN to fight Pb in vivo. Swiss mice with subcutaneous air pouches were inoculated with a virulent strain of Pb or fungal cell wall components (Zymosan), and then received LLLT (780 nm; 50 mW; 12.5 J/cm2; 30 seconds per point, giving a total energy of 0.5 J per point) on alternate days at two points on each hind leg. The aim was to reach the bone marrow in the femur with light. Non-irradiated animals were used as controls. The number and viability of the PMN that migrated to the inoculation site was assessed, as well as their ability to synthesize proteins, produce reactive oxygen species (ROS) and their fungicidal activity. The highly pure PMN populations obtained after 10 days of infection were also subsequently cultured in the presence of Pb for trials of protein production, evaluation of mitochondrial activity, ROS production and quantification of viable fungi growth. PMN from mice that received LLLT were more active metabolically, had higher fungicidal activity against Pb in vivo and also in vitro. The kinetics of neutrophil protein production also correlated with a more activated state. LLLT may be a safe and non-invasive approach to deal with PCM infection.

In Vivo Determination Of The Volatile Metabolites Of Saprotroph Fungi By Comprehensive Two-dimensional Gas Chromatography.

In this work, we discuss the use of multi-way principal component analysis combined with comprehensive two-dimensional gas chromatography to study the volatile metabolites of the saprophytic fungus Memnoniella sp. isolated in vivo by headspace solid-phase microextraction. This fungus has been identified as having the ability to induce plant resistance against pathogens, possibly through its volatile metabolites. Adequate culture media was inoculated, and its headspace was then sampled with a solid-phase microextraction fiber and chromatographed every 24 h over seven days. The raw chromatogram processing using multi-way principal component analysis allowed the determination of the inoculation period, during which the concentration of volatile metabolites was maximized, as well as the discrimination of the appropriate peaks from the complex culture media background. Several volatile metabolites not previously described in the literature on biocontrol fungi were observed, as well as sesquiterpenes and aliphatic alcohols. These results stress that, due to the complexity of multidimensional chromatographic data, multivariate tools might be mandatory even for apparently trivial tasks, such as the determination of the temporal profile of metabolite production and extinction. However, when compared with conventional gas chromatography, the complex data processing yields a considerable improvement in the information obtained from the samples. This article is protected by copyright. All rights reserved.

Caracterização morfológica das sementes e plântulas de seis espécies invasoras do gênero Solanum L

Morphological caracterization of the seeds and seedlings of six weed especies of the genus Solanum L. The seeds of the genus Solanum are very similar, however, the association of their external characteristics with the anatomical features, such as hilum shape, the texture and the type of the seed coat sculptures, as well as the curved (circulated or coiled) shape of the embryo, are parameters of great importance in the taxonomical identification at the species level. It is are presented the morphological descriptions of the genus Solanum and a more detailed description of each studied species in terms of seed and seedling structures, including illustrations and taxonomical keys for the identification of Solanum aculeatissimum Jacq., S. americanum Mill., S. ciliatum Lam., S. sisymbriifolium Lam., S. sordidum Sendt. e S. viarum Dunal. There are also indications of the common names, the type of reproduction and dispersion, the crops in which the species is considered as a weed and the agricultural seeds in which it is found as a weed seed.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Influência da luminosidade e da camada de cera epicuticular de superfícies de folhas de soja na infecção de Phakopsora pachyrhizi

A ferrugem asiática, causada pelo fungo Phakopsora pachyrhizi, apresenta-se como um dos mais graves problemas fitossanitários da cultura da soja no Brasil, principalmente por não existirem, até o presente momento, cultivares com níveis de resistência satisfatórios. Objetivou-se estudar a influência da luminosidade e da camada de cera das superfícies foliares na infecção de folhas de soja por P. pachyrhizi. A superfície adaxial ou abaxial de folíolos do primeiro trifólio de plantas da cultivar BRS 154, estádio fenológico V2, foi inoculada com suspensão de 10(5) urediniósporos/mL-1. As plantas foram mantidas por 24 horas em câmara úmida e temperatura de 23ºC, sob luz ou escuro, em delineamento fatorial. Posteriormente, permaneceram 14 dias em fotoperíodo de 12 horas, sendo em seguida avaliada a densidade de lesões e a severidade da doença. Em um segundo experimento, avaliou-se in vitro , no escuro e na luz, a porcentagem de germinação de urediniósporos e de formação de apressórios. As camadas de cera adaxial e abaxial dos folíolos foram analisadas quantitativamente (extrações com clorofórmio) e estruturalmente (microscopia eletrônica de varredura). A densidade de lesões e a severidade foram maiores quando se inoculou a superfície adaxial de plantas incubadas no escuro, sem interação significativa entre os fatores. A germinação dos esporos no escuro (40,7%) foi significativamente superior à germinação na luz (28,5%). O mesmo ocorreu para a formação de apressórios, no escuro (24,7%) e na luz (12,8%). A quantidade e a estrutura das ceras epicuticulares não apresentaram diferenças entre as duas superfícies.

A multi-screening approach for marine-derived fungal metabolites and the isolation of cyclodepsipeptides from Beauveria felina

Extracts obtained from 57 marine-derived fungal strains were analyzed by HPLC-PDA, TLC and ¹H NMR. The analyses showed that the growth conditions affected the chemical profile of crude extracts. Furthermore, the majority of fungal strains which produced either bioactive of chemically distinctive crude extracts have been isolated from sediments or marine algae. The chemical investigation of the antimycobacterial and cytotoxic crude extract obtained from two strains of the fungus Beauveria felina have yielded cyclodepsipeptides related to destruxins. The present approach constitutes a valuable tool for the selection of fungal strains that produce chemically interesting or biologically active secondary metabolites.

Experimental infections with Paracoccidioides brasiliensis obtained from armadillos: comparison to clinical isolates

Paracoccidioides brasiliensis causes paracoccidioidomycosis (PCM) that is one of the most prevalent systemic human mycoses in Latin America. Armadillos show a high incidence of PCM infection and could, therefore, be a natural reservoir for this fungus. In this study were compared the virulence profiles of isolates obtained from nine-banded armadillos (Dasypus novemcinctus) (PbT1 and PbT4) and isolates from PCM patients (Pb265 and Bt83). Pathogenicity was evaluated by fungal load and analysis of colony morphology. Immunity against the fungus was tested by delayed type hypersensitivity test (DTH) and antibody quantification by ELISA. The higher virulence of PbT1 and PbT4 was suggested by higher fungal load in spleen and lungs. Armadillo isolates and Bt83 presented a cotton-like surface contrasting with the cerebriform appearance of Pb265. All isolates induced cellular and humoral immune responses in infected BALB/c mice. DTH reactions were similarly induced by the four isolates, however, a great variability was observed in specific antibody levels, being the highest ones induced by Bt83 and PbT4. The present work confirms that armadillos harbor P. brasiliensis, whose multiplication and induced immunity in experimentally infected mice are heterogeneous, resembling the behavior of isolates from human PCM. This study reinforces the possibility that armadillos play an important role in the biological cycle of this pathogen.

Larva of Atractocerus Brasiliensis (Lepeletier & Audinet-Serville, 1825) (Lymexylidae, Atractocerinae)

The larva of Atractocerus brasiliensis (Lepeletier & Audinet-Serville, 1825), collected for the first time in Pinus oocarpa Schiede ex Schltdl. (Pinaceae) is described and illustrated. Until now, for Lymexylidae, only the larva of Melittomma sp. (Melittomminae) was known from the neotropical region (Brazil). Biological notes, a comparison with the description of A. brevicornis, the type-species of the genus (recorded from Africa and Madagascar), and history of the known lymexylid larvae are also included.

Gene expression profile of the plant pathogen Fusarium graminearum under the antagonistic effect of Pantoea agglomerans

The pathogenic fungus Fusarium graminearum is an ongoing threat to agriculture, causing losses in grain yield and quality in diverse crops. Substantial progress has been made in the identification of genes involved in the suppression of phytopathogens by antagonistic microorganisms; however, limited information regarding responses of plant pathogens to these biocontrol agents is available. Gene expression analysis was used to identify differentially expressed transcripts of the fungal plant pathogen F. graminearum under antagonistic effect of the bacterium Pantoea agglomerans. A macroarray was constructed, using 1014 transcripts from an F. graminearum cDNA library. Probes consisted of the cDNA of F. graminearum grown in the presence and in the absence of P. agglomerans. Twenty-nine genes were either up (19) or down (10) regulated during interaction with the antagonist bacterium. Genes encoding proteins associated with fungal defense and/or virulence or with nutritional and oxidative stress responses were induced. The repressed genes coded for a zinc finger protein associated with cell division, proteins containing cellular signaling domains, respiratory chain proteins, and chaperone-type proteins. These data give molecular and biochemical evidence of response of F. graminearum to an antagonist and could help develop effective biocontrol procedures for pathogenic plant fungi.

Radial variation of anatomical features, wood density and decay resistance in teak (Tectona grandis) from two qualities of growing sites and two climatic regions of Costa Rica

The objective of this study was to show the radial variation of some anatomic characteristics, wood density and natural durability of teak (Tectona grandis L.F.) growing in Costa Rica. Samples of trees 13 years old were obtained from two growing sites (high and low growing) of plantations established in a humid tropical climate (CHT) and dry tropical climate (CST). The variables measured of the fibers as well as for the rays were not affected by the climate or the type of growing site, except for the length of the fibers. The fibers of teak wood from the best growing site were significantly larger. Vessels were found with a greater frequency for the CST but mostly solitary in comparison with the CBT. Average density, maximum density and the variation within the ring presented a light higher magnitude for the CST. The quality of the growing site did not affect these variables. The resistance of fungus attack was similar in the area of heartwood near the pith compared to the heartwood near the sapwood for all the conditions evaluated. Nevertheless, it was observed in some trees a similar resistance of fungus attack for areas of sapwood compared to similar areas of heartwood.

Enzymatic differences between the endophyte Guignardia mangiferae (Botryosphaeriaceae) and the citrus pathogen G. citricarpa

The endophyte Guignardia mangiferae is closely related to G. citricarpa, the causal agent of citrus black spot; for many years these species had been confused with each other. The development of molecular analytical methods has allowed differentiation of the pathogen G. citricarpa from the endophyte G. mangiferae, but the physiological traits associated with pathogenicity were not described. We examined genetic and enzymatic characteristics of Guignardia spp strains; G. citricarpa produces significantly greater amounts of amylases, endoglucanases and pectinases, compared to G. mangiferae, suggesting that these enzymes could be key in the development of citrus black spot. Principal component analysis revealed pectinase production as the main enzymatic characteristic that distinguishes these Guignardia species. We quantified the activities of pectin lyase, pectin methylesterase and endopolygalacturonase; G. citricarpa and G. mangiferae were found to have significantly different pectin lyase and endopolygalacturonase activities. The pathogen G. citricarpa is more effective in pectin degradation. We concluded that there are significant physiological differences between the species G. citricarpa and G. mangiferae that could be associated with differences in pathogenicity for citrus plants.

Paracoccidioides brasilinsis-Induced Migration of Dendritic Cells and Subsequent T-Cell Activation in the Lung-Draining Lymph Nodes

Paracoccidioidomycosis is a mycotic disease caused by a dimorphic fungus, Paracoccidioides brasiliensis (Pb), that starts with inhalation of the fungus; thus, lung cells such as DC are part of the first line of defense against this microorganism. Migration of DC to the lymph nodes is the first step in initiating T cell responses. The mechanisms involved in resistance to Pb infection are poorly understood, but it is likely that DC play a pivotal role in the induction of effector T cells that control Pb infection. In this study, we showed that after Pb Infection, an important modification of lung DC receptor expression occurred. We observed an increased expression of CCR7 and CD103 on lung DC after infection, as well as MHC-II. After Pb infection, bone marrow-derived DC as well lung DC, migrate to lymph nodes. Migration of lung DC could represent an important mechanism of pathogenesis during PCM infection. In resume our data showed that Pb induced DC migration. Furthermore, we demonstrated that bone marrow-derived DC stimulated by Pb migrate to the lymph nodes and activate a T helper (Th) response. To the best of our knowledge, this is the first reported data showing that Pb induces migration of DC and activate a T helper (Th) response.

Sub-telomere directed gene expression during initiation of invasive aspergillosis

Aspergillus fumigatus is a common mould whose spores are a component of the normal airborne flora. Immune dysfunction permits developmental growth of inhaled spores in the human lung causing aspergillosis, a significant threat to human health in the form of allergic, and life-threatening invasive infections. The success of A. fumigatus as a pathogen is unique among close phylogenetic relatives and is poorly characterised at the molecular level. Recent genome sequencing of several Aspergillus species provides an exceptional opportunity to analyse fungal virulence attributes within a genomic and evolutionary context. To identify genes preferentially expressed during adaptation to the mammalian host niche, we generated multiple gene expression profiles from minute samplings of A. fumigatus germlings during initiation of murine infection. They reveal a highly co-ordinated A. fumigatus gene expression programme, governing metabolic and physiological adaptation, which allows the organism to prosper within the mammalian niche. As functions of phylogenetic conservation and genetic locus, 28% and 30%, respectively, of the A. fumigatus subtelomeric and lineage-specific gene repertoires are induced relative to laboratory culture, and physically clustered genes including loci directing pseurotin, gliotoxin and siderophore biosyntheses are a prominent feature. Locationally biased A. fumigatus gene expression is not prompted by in vitro iron limitation, acid, alkaline, anaerobic or oxidative stress. However, subtelomeric gene expression is favoured following ex vivo neutrophil exposure and in comparative analyses of richly and poorly nourished laboratory cultured germlings. We found remarkable concordance between the A. fumigatus host-adaptation transcriptome and those resulting from in vitro iron depletion, alkaline shift, nitrogen starvation and loss of the methyltransferase LaeA. This first transcriptional snapshot of a fungal genome during initiation of mammalian infection provides the global perspective required to direct much-needed diagnostic and therapeutic strategies and reveals genome organisation and subtelomeric diversity as potential driving forces in the evolution of pathogenicity in the genus Aspergillus.

Cell-Free Antigens from Paracoccidioides brasiliensis Drive IL-4 Production and Increase the Severity of Paracoccidioidomycosis

The thermally dimorphic fungus Paracoccidioides brasiliensis (Pb) is the causative agent of paracoccidioidomycosis (PCM), one of the most frequent systemic mycosis that affects the rural population in Latin America. PCM is characterized by a chronic inflammatory granulomatous reaction, which is consequence of a Th1-mediated adaptive immune response. In the present study we investigated the mechanisms involved in the immunoregulation triggered after a prior contact with cell-free antigens (CFA) during a murine model of PCM. The results showed that the inoculation of CFA prior to the infection resulted in disorganized granulomatous lesions and increased fungal replication in the lungs, liver and spleen, that paralleled with the higher levels of IL-4 when compared with the control group. The role of IL-4 in facilitating the fungal growth was demonstrated in IL-4-deficient- and neutralizing anti-IL-4 mAb-treated mice. The injection of CFA did not affect the fungal growth in these mice, which, in fact, exhibited a significant diminished amount of fungus in the tissues and smaller granulomas. Considering that in vivo anti-IL-4-application started one week after the CFA-inoculum, it implicates that IL-4-CFA-induced is responsible by the mediation of the observed unresponsiveness. Further, the characterization of CFA indicated that a proteic fraction is required for triggering the immunosuppressive mechanisms, while glycosylation or glycosphingolipids moieties are not. Taken together, our data suggest that the prior contact with soluble Pb antigens leads to severe PCM in an IL-4 dependent manner.