977 resultados para Fumée entière de cigarette
Resumo:
Seasonally dry tropical plant formations (SDTF) are likely to exhibit phylogenetic clustering owing to niche conservatism driven by a strong environmental filter (water stress), but heterogeneous edaphic environments and life histories may result in heterogeneity in degree of phylogenetic clustering. We investigated phylogenetic patterns across ecological gradients related to water availability (edaphic environment and climate) in the Caatinga, a SDTF in Brazil. Caatinga is characterized by semiarid climate and three distinct edaphic environments - sedimentary, crystalline, and inselberg -representing a decreasing gradient in soil water availability. We used two measures of phylogenetic diversity: Net Relatedness Index based on the entire phylogeny among species present in a site, reflecting long-term diversification; and Nearest Taxon Index based on the tips of the phylogeny, reflecting more recent diversification. We also evaluated woody species in contrast to herbaceous species. The main climatic variable influencing phylogenetic pattern was precipitation in the driest quarter, particularly for herbaceous species, suggesting that environmental filtering related to minimal periods of precipitation is an important driver of Caatinga biodiversity, as one might expect for a SDTF. Woody species tended to show phylogenetic clustering whereas herbaceous species tended towards phylogenetic overdispersion. We also found phylogenetic clustering in two edaphic environments (sedimentary and crystalline) in contrast to phylogenetic overdispersion in the third (inselberg). We conclude that while niche conservatism is evident in phylogenetic clustering in the Caatinga, this is not a universal pattern likely due to heterogeneity in the degree of realized environmental filtering across edaphic environments. Thus, SDTF, in spite of a strong shared environmental filter, are potentially heterogeneous in phylogenetic structuring. Our results support the need for scientifically informed conservation strategies in the Caatinga and other SDTF regions that have not previously been prioritized for conservation in order to take into account this heterogeneity.
Resumo:
The objective of this study was to analyze changes in the spectral behavior of the soybean crop through spectral profiles of the vegetation indexes NDVI and GVI, expressed by different physical values such as apparent bi-directional reflectance factor (BRF), surface BRF, and normalized BRF derived from images of the Landsat 5/TM. A soybean area located in Cascavel, Paraná, was monitored by using five images of Landsat 5/TM during the 2004/2005 harvesting season. The images were submitted to radiometric transformation, atmospheric correction and normalization, determining physical values of apparent BRF, surface BRF and normalized BRF. NDVI and GVI images were generated in order to distinguish the soybean biomass spectral response. The treatments showed different results for apparent, surface and normalized BRF. Through the profiles of average NDVI and GVI, it was possible to monitor the entire soybean cycle, characterizing its development. It was also observed that the data from normalized BRF negatively affected the spectral curve of soybean crop, mainly, during the phase of vegetative growth, in the 12-9-2004 image.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas. Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
A biologia molecular tem fornecido as ferramentas básicas para os geneticistas se aprofundarem nos mecanismos moleculares que influem na variação das doenças. Deve-se destacar a responsabilidade científica e moral dos pesquisadores, uma vez que os cientistas devem imaginar as consequências morais da aplicação comercial de testes genéticos, já que esse fato envolve não só o indivíduo e suas famílias, mas toda a população. Além de ser preciso, também, fazer uma reflexão sobre como essas informações do genoma humano serão utilizadas, para o bem ou mal. O objetivo desta revisão foi trazer à luz do conhecimento dados sobre características éticas da aplicação da biologia molecular, relacionando-a com os direitos do ser humano. Após análise bibliográfica, pôde-se observar que o Projeto Genoma Humano gerou várias possibilidades, como identificação de genes associados a doenças com propriedades sinergísticas, mas modificando às vezes comportamentos ao intervir geneticamente no ser humano, trazendo benefícios ou malefícios sociais. O grande desafio é decidir o que a humanidade pretende em relação a este gigantesco salto.
Resumo:
Este estudo caracteriza-se epidemiológico-descritivo com objetivo de descrever a evolução temporal dos casos de dengue em Ribeirão Preto, São Paulo, no período de 1994 a 2003, segundo mês de ocorrência e sexo. Os dados foram obtidos junto às fichas de notificação compulsória fornecidas pela Vigilância Epidemiológica da Secretaria Municipal de Saúde do município. Foram obtidos os coeficientes de incidência por 100.000 habitantes, segundo estimativas populacionais do Instituto Brasileiro de Geografia e Estatística. O município viveu uma epidemia de dengue no ano de 2001, quando o coeficiente de incidência chegou a 619,65 casos/100.000 habitantes, sendo que dentre os 5.553 casos encontrados no período estudado, 0,07% ocorreram no ano de 1994, 3,68% em 1995, 4,52% em 1996, 2,40% em 1997, 1,82% em 1998, 5,73% em 1999, 3,75% em 2000, 57,37% em 2001, 6,25% em 2002 e, 14,39% em 2003 . Os meses do ano de maior ocorrência da doença foram de janeiro a maio. Em relação à variável sexo, a proporção entre o número de casos foi de aproximadamente 1:1, mostrando pequenas flutuações de casos de dengue entre homens e mulheres, para todo período estudado. Os resultados apontam a necessidade do desenvolvimento de estudos sobre a temática e reforçam o papel das instituições de ensino na questão da dengue no nosso país.
Resumo:
The aim of this study was to evaluate the microbial distribution in the root canal system after periapical lesion induction in dogs' teeth using different methods. Fifty-two root canals were assigned to 4 groups (n=13). Groups I and II: root canals were exposed to the oral cavity for 180 days; groups III and IV: root canals were exposed for 7 days and then the coronal openings were sealed for 53 days. The root apices of groups I and III were perforated, while those of groups II and IV remained intact. After the experimental periods, the animals were euthanized and the anatomic pieces containing the roots were processed and stained with the Brown & Brenn method to assess the presence and distribution of microorganisms. The incidence of microorganisms at different sites of the roots and periapical lesions was analyzed statistically by the chi-square test at 5% significance level. All groups presented microorganisms in the entire root canal system. A larger number of microorganisms was observed on the root canal walls, apical delta and dentinal tubules (p<0.05), followed by cementum and cemental resorption areas. In spite of the different periods of exposure to the oral environment, the methods used for induction of periapical periodontitis yielded similar distribution of microorganisms in the root canal system.
Resumo:
OBJETIVOS: avaliar a expressão de erbB-2 e dos receptores hormonais para estrógeno e progesterona (RE/RP) nas regiões de transição entre as frações in situ e invasoras de neoplasias ductais da mama (CDIS e CDI, respectivamente). MÉTODOS: oitenta e cinco casos de neoplasias mamárias, contendo regiões contíguas de CDIS e CDI, foram selecionados. Espécimes histológicos das áreas de CDIS e de CDI foram obtidos através da técnica de tissue microarray (TMA). As expressões da erbB-2 e dos RE/RP foram avaliadas por meio de imunoistoquímica convencional. A comparação da expressão da erbB-2 e dos RE/RP nas frações in situ e invasoras da mama foi realizada com emprego do teste de McNemar. Os intervalos de confiança foram determinados em 5% (p=0,05). Foram calculados coeficientes de correlação intraclasse (ICC) para avaliar a concordância na tabulação cruzada da expressão de erbB-2 e RE/RP nas frações de CDIS e CDI. RESULTADOS: a expressão da erbB-2 não diferiu entre as áreas de CDIS e CDI (p=0,38). Comparando caso a caso suas áreas de CDIS e CDI, houve boa concordância na expressão da erbB-2 (coeficiente de correlação intraclasse, ICC=0,64), dos RP (ICC = 0,71) e dos RE (ICC = 0,64). Considerando apenas tumores cujo componente in situ apresentasse áreas de necrose (comedo), o ICC para erbB-2 foi de 0,4, comparado a 0,6 no conjunto completo de casos. Os ICC não diferiram substancialmente daqueles obtidos com o conjunto completo de espécimes em relação aos RE/RP: para RE, ICC=0,7 (versus 0,7 no conjunto completo), e para RP, ICC=0,7 (versus 0,6 no conjunto completo). CONCLUSÕES: nossos achados sugerem que as expressões de erbB-2 e RE/RP não diferem nos componentes contíguos in situ e invasivo em tumores ductais da mama.