977 resultados para site factors
Resumo:
Caesium titanium alum, CsTi(SO4)(2) . 12H(2)O, is a beta alum and exhibits a large trigonal field and a dynamic Jahn-Teller effect. Exact calculations of the linear (2)T(2)xe Jahn-Teller coupling show that in the strict S-6 Site symmetry the ground multiplet consists of a Kramers doublet 2 Gamma(6) with magnetic splitting factors g(parallel to)=1.1 and g perpendicular to=0, a Gamma(4) Gamma(5) doublet at similar to 60 cm(-1) with g(parallel to)=2.51 and g(perpendicular to)=0.06 and another Gamma(4) Gamma(5) doublet at similar to 270 cm(-1) with g(parallel to)=1.67 and g(perpendicular to)=1.83. The controversial g values observed below 4.2 K, g(parallel to)=1.25 and g(perpendicular to)=1.14, are shown to arise from low symmetry distortions. These distortions couple the vibronic levels and induce into the ground state the off-diagonal axial Zeeman interaction that exists between the first excited and the ground vibronic levels. (C) 1997 American Institute of Physics.
Resumo:
Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).
Resumo:
Protrusion of the abdominal wall secondary to abdominoplasty may occur in patients with weakness of the aponeurotic structures. The anterior layer of the rectus abdominis muscle consists of fibers that are transverse rather than vertical. Based on this anatomical feature, vertical sutures are suggested for the correction of diastasis recti, since they include a greater amount of fascial fibers and thus would be more resistant to tensile strength than horizontal ones. The anterior layers of the rectus abdominis muscles of 15 fresh cadavers were dissected. Two vertical lines were marked on each side of the linea alba, corresponding to the site where plication is usually performed in abdominoplasties. Three abdominal levels were evaluated: the supraumbilical, umbilical, and infraumbilical levels. A simple suture was placed in the vertical direction in one group and in the horizontal direction in the other group, at each of the three levels previously described. These sutures were connected to a dynamometer, which was pulled medially toward the linea alba until rupture of the aponeurosis occurred. The mean strength required to rupture the aponeurotic structures in which the vertical sutures had been placed was greater than for the horizontal ones (p < 0.0001). The vertical suture of the rectus abdominis sheaths was stronger than the horizontal suture because of the more transversal arrangement of its aponeurotic fibers. Thus, routine use of the vertical suture in plications of the aponeurosis of the rectus abdominis muscles is suggested.
Resumo:
Objectives: The aim of this study was to determine whether the addition of the measurement of bilateral hip bone mineral density (BMD) has an impact on indications for osteoporosis (OP) treatment in community-dwelling elderly individuals, based on criteria from the National Osteoporosis Foundation (NOF). Methods: In total, 605 consecutive community-dwelling elderly individuals who were 65 years and older were evaluated. Dual energy X-ray absorptiometry was used to determine the lowest T-score in the lumbar spine + unilateral hip, the bilateral hips, and the lumbar spine + bilateral hips. Risk factors associated with the lowest T-score in these three conditions were applied to indicate treatment in accordance with NOF criteria. McNemar`s test was used to assess the difference of adding bilateral hip BMD measurements. Results: There was a significant difference in the frequency of pharmacological indication using NOF criteria together with the lowest T-score for the three tests (72.8% for lumbar spine + bilateral hips and 71.2% for lumbar spine + unilateral hip; p=0.002). A higher frequency of treatment indication was also observed for lumbar spine + unilateral hip (71.2%) compared to bilateral hips (61.1%) (p<0.001). The discrepancies in treatment appeared to be more evident in women when analyzed by gender distribution. Conclusion: Our finding supports the theory that evaluation of the bilateral hips with the lumbar spine seems to be more sensitive measure for identifying patients with an osteoporosis treatment indication. Furthermore, despite the well-known artifact in the lumbar spine, this site should not be excluded when determining the indication for OP treatment in elderly people. (C) 2009 Elsevier Ireland Ltd. All rights reserved.
Resumo:
Background: Sudden unexpected cardiac death (SUCD) accounts for approximately 25% of deaths from ischaemic heart disease (IHD) but is relatively poorly understood because of the difficulties involved in researching aetiology. Clinical differences between instances of SUCD and those cases of acute chest pain that survive long enough to be proven as myocardial infarction but are eventually fatal might reflect differences in aetiology. Aims: To determine the risk factors for sudden unexpected cardiac death in Tasmanian men. Methods: A population-based case-control method was used with the study population, an estimated 125,225 men aged 25-74 years living in the island State of Tasmania, Australia. The case group of 102 men who had a SUCD was validated using necropsy reports, hospital records and information provided by the usual general practitioner. Cases were matched with 204 community controls. Spouses or partners of eligible subjects answered a detailed questionnaire. Multi-variate odds ratios (ORs) for risk factors were calculated using stepwise analysis. Results: Risk factors measured included: smoking habit, treated hypertension, hypercholesterolaemia, diabetes mellitus, family history of LHD, alcohol intake and exercise habits. Independent risk factors for SUCD were: history of diabetes mellitus (OR=4.2, 95% CI: 1.39, 12.81), current smoking status (OR=3.5, 95% CI: 1.80, 6.82), and family history of IHD (OR=2.6, 95% CI: 1.34, 4.92). Conclusions: Some accepted risk factors for acute myocardial infarction (AMI) also predict sudden death in men with no history of coronary disease. Efforts to reduce smoking, the incidence of diabetes mellitus and mean blood pressure must be continued as SUCD is, by definition, untreatable but is potentially avoidable in many instances.
Resumo:
We reviewed the data of 307 patients treated with autologous bone marrow transplantation with the aim to identify factors associated with poor hematopoietic stern cell (HSC) mobilization after administration of cyclophosphamide and granulocyte-colony stimulating factor. Success in mobilization was defined when >= 2.0 x 10(6) CD34+ cells/kg weight could be collected with <= 3 leukapheresis procedures. Success was observed in 260 patients (84.7%) and nonsuccess in 47 patients (15.3%). According to the stepwise regression model: diagnosis, chemotherapy load, treatment with mitoxantrone and platelet count before mobilization were found to be independent predictive factors for HSC mobilization. These results could help in the previous recognition of patients at risk for non response to mobilization and allow to plan an alternative protocol for this group of patients. (C) 2008 Elsevier Ltd. All rights reserved.
Resumo:
Purpose: Animal models of diseases are extremely important in the study of the physiopathogenesis of human diseases and for testing novel therapeutic interventions. The present study aimed to develop an animal model that simulates human allergic conjunctivitis and to study how allergic response may be influenced by the allergen dose used for immunization and by genetic factors. Methods: Sixty C57Bl/6 mice and 60 BALB/c mice were immunized with placebo, or 5 mu g or 500 mu g of allergen derived from Dermatophagoides pteronyssinus. After ocular challenge, the mice were examined in order to clinically verify the occurrence or not of conjunctivitis. Material obtained from animals was used for total and specific IgE and IgG1 dosage, for assays of Der p-specific lymphocyte proliferation and supernatant cytokine dosage, and for histopathological evaluation of conjunctiva. Results: We developed a murine model of allergic conjunctivitis induced by D. pteronyssinus. The model is similar to human disease both clinically and according to laboratory findings. In mouse, conjunctivitis was associated with a Th2 cytokine profile. However, IL-10 appeared to be involved with disease blockade. Mice of different strains have distinct immune responses, depending on the sensitization dose. Conclusions: The murine model developed is suitable for the study of immunopathogenesis and as a template for future therapies. Using BALB/c and C57BL/6 mice, we demonstrated that genetic factors play a role in determining susceptibility and resistance, as well as in establishing the allergen concentration needed to induce or to block disease development.
Resumo:
Background: To investigate the association between cardiovascular risk-factor profile and migraine in the elderly, we evaluated a population sample of ageing men and women (65 years or more) living in a low-income area in the city of Sao Paulo, Brazil. Patients and Methods: We investigated migraine status and cardiovascular profile from a baseline of 1450 participants (65-102 years of age) of the Sao Paulo Ageing & Health Study (SPAH), a longitudinal population-based study with low-income elderly in Brazil. The following age and sex-adjusted cardiovascular risk factors were analyzed: blood pressure, pulse pressure, serum total and high-density lipoprotein cholesterol, body mass index, smoking, history of hypertension, diabetes and the 10-year risk of myocardial infarction or coronary heart disease death based on the Framingham Risk Score. Results: The overall prevalence of migraine was 11.4%, and it was 3 times more frequent among women than men (15.3% vs 5.4%; P < 0.0001). Migraineurs were younger than non-migraineurs (mean age 70.6 years vs 72.1 years; P = 0.001, respectively). There was no statistically significant difference regarding the cardiovascular risk-factor profile after adjustment for age and sex among migraineurs and non-migraineurs. Only a decrease in the risk of hypertension among women (OR 0.58; 95% CI 0.38-0.90; P = 0.01) was also observed even after adjustment for age. Conclusions: Overall, we did not find a worse cardiovascular risk profile among elderly migraineurs. An inverse association between hypertension and migraine in women warrants further investigation.
Resumo:
Objectives: To compare prognosis parameters and arterial site involvement in Takayasu arteritis (TA) patients with disease onset at age <= 18 and >= 21 years. Methods: Sixty-two TA patients [American College of Rheumatology (ACR) and European League Against Rheumatism/Paediatric Rheumatology European Society (EULAR/PreS) criteria] were enrolled consecutively and divided into two groups according to disease onset, and matched for disease duration: juvenile TA patients aged <= 18 years (n = 17) and adult TA patients aged >= 21 years (n = 45). The protocol evaluated the following prognostic factors: aortic insufficiency, ischaemic retinopathy, severe systemic hypertension, and arterial aneurysms. In addition, death and remission [defined as stable disease > 6 months (no complaints without immunosuppressive and prednisone use) and normal erythrocyte sedimentation rate (ESR)] were also analysed. Stenosis and aneurisms were investigated by magnetic angioresonance or arteriography and angiographic classification was defined according to Hata criteria. Results: Mean disease duration was similar in the juvenile and adult TA groups (13.50 +/- 10.73 vs. 13.80 +/- 7.17 years, p = 0.092) and a trend to a lower predominance of female gender in the juvenile TA group was observed (64.71% vs. 88.89%, p = 0.056). The prognosis was distinct in the two groups, with juvenile patients having a lower frequency of disease remission (23.53% vs. 55.56%, p = 0.04) and a significantly higher frequency of aneurism (41.0% vs. 11.1%, p = 0.013). Almost half of the juvenile TA patients had left renal stenosis, a frequency significantly higher than in the adult TA group (41.18% vs. 11.10%, p = 0.013), whereas the stenosis frequency was comparable in all other vascular sites evaluated. No differences were observed between the two groups regarding the frequency of aortic insufficiency, ischaemic retinopathy, severe systemic arterial hypertension, vascular procedures, and mortality. Angiographic classification revealed a similar distribution of arterial involvement in both groups (p > 0.05). Conclusions: Juvenile TA patients have distinct characteristics, with a peculiar renal vascular involvement, the presence of aneurism, and a more refractory disease compared with adult TA patients.
Resumo:
The efficient and correct folding of bacterial disulfide bonded proteins in vivo is dependent upon a class of periplasmic oxidoreductase proteins called DsbA, after the Escherichia coli enzyme. In the pathogenic bacterium Vibrio cholerae, the DsbA homolog (TcpG) is responsible for the folding, maturation and secretion of virulence factors. Mutants in which the tcpg gene has been inactivated are avirulent; they no longer produce functional colonisation pill and they no longer secrete cholera toxin. TcpG is thus a suitable target for inhibitors that could counteract the virulence of this organism, thereby preventing the symptoms of cholera. The crystal structure of oxidized TcpG (refined at a resolution of 2.1 Angstrom) serves as a starting point for the rational design of such inhibitors. As expected, TcpG has the same fold as E. coli DsbA, with which it shares similar to 40% sequence identity. Ln addition, the characteristic surface features of DsbA are present in TcpG, supporting the notion that these features play a functional role. While the overall architecture of TcpG and DsbA is similar and the surface features are retained in TcpG, there are significant differences. For example, the kinked active site helix results from a three-residue loop in DsbA, but is caused by a proline in TcpG (making TcpG more similar to thioredoxin in this respect). Furthermore, the proposed peptide binding groove of TcpG is substantially shortened compared with that of DsbA due to a six-residue deletion. Also, the hydrophobic pocket of TcpG is more shallow and the acidic patch is much less extensive than that of E. coli DsbA. The identification of the structural and surface features that are retained or are divergent in TcpG provides a useful assessment of their functional importance in these protein folding catalysts and is an important prerequisite for the design of TcpG inhibitors. (C) 1997 Academic Press Limited.
Resumo:
Various members of the bZip and bHLH-Zip families of eukaryotic transcription factors, including Jun, Fos, and Myc, have been identified as oncoproteins; mutation or deregulated expression of these proteins leads to certain types of cancer. These proteins can only bind to their cognate DNA enhancer sites following homodimerization, or heterodimerization with another family member, via their leucine zipper domain. Thus, a novel anticancer strategy would be to inhibit dimerization of these proteins, thereby blocking their DNA binding and transactivation functions. In this paper we show that it is possible to rationally design leucine zipper peptides that bind with high affinity to the leucine zipper dimerization domains of c-Jun and c-Fos, thus preventing the formation of functional c-Jun homodimers and c-Jun:c-Fos heterodimers; we refer to such peptides as superzippers (SZs). In vivo, c-Jun:SZ and c-Fos:SZ heterodimers should be nonfunctional as they lack one of the two basic domains that are essential for DNA binding. While the transport of a peptidic agent into cells often poses a severe obstacle to its therapeutic use, we show that a 46-residue leucine zipper peptide can be transported into HeLa cells by coupling it to a 17-residue carrier peptide from the Antennapedia homeodomain, thus paving the way for detailed studies of the therapeutic potential of superzipper peptides.
Resumo:
DsbA is a protein-folding catalyst from the periplasm of Escherichia coli that interacts with newly translocated polypeptide substrate and catalyzes the formation of disulfide bonds in these secreted proteins. The precise nature of the interaction between DsbA and unfolded substrate is not known. Here, we give a detailed analysis of the DsbA crystal structure, now refined to 1.7 Angstrom, and present a proposal for its interaction with peptide. The crystal structure of DsbA implies flexibility between the thioredoxin and helical domains that may be an important feature for the disulfide transfer reaction. A hinge point for domain motion is identified-the typo IV beta-turn Phe 63-Met 64-Gly 65-Gly 66, which connects the two domains. Three unique features on the active site surface of the DsbA molecule-a groove, hydrophobic pocket, and hydrophobic patch-form an extensive uncharged surface surrounding the active-sits disulfide. Residues that contribute to these surface features are shown to be generally conserved in eight DsbA homologues. Furthermore, the residues immediately surrounding the active-site disulfide are uncharged in all nine DsbA proteins. A model for DsbA-peptide interaction has been derived from the structure of a human thioredoxin:peptide complex. This shows that peptide could interact with DsbA in a manner similar to that with thioredoxin. The active-site disulfide and all three surrounding uncharged surface features of DsbA could, in principle, participate in the binding or stabilization of peptide.
Resumo:
Background: Insulin resistance and obesity are recognized as left ventricular (LV) mass determinants independent of blood pressure (BP). Prevalence of LV hypertrophy (LVH) and the relationship between LV mass to body composition and metabolic variables were evaluated in normotensive individuals as participants of a population-based study. Methods: LV mass was measured using the second harmonic image by M-mode 2D guided echocardiography in 326 normotensive subjects (mean 47 +/- 9.4 years). Fasting serum lipids and glucose, BP, body composition and waist circumference (WC) were recorded during a clinic visit. Results: Applying a normalization criterion not related to body weight (g/height raised to the power 2.7) and the cut-off points of 47.7 (men) and 46.6 g/m(2.7) (women), LVH was found in 7.9% of the sample. Univariate analysis showed LV mass (g/m(2.7)) related to age, body mass index (BMI), WC, fat and lean body mass, systolic and diastolic BP, and metabolic variables (cholesterol, HDL-c, triglycerides and glucose). In multivariate analysis only BMI and age-adjusted systolic BP remained as independent predictors of LV mass, explaining 31% and 5% of its variability. Removing BMI from the model, WC, age-adjusted systolic BP and lean mass remained independent predictors, explaining 25.0%, 4.0% and 1.5% of LV mass variability, respectively. After sex stratification, LV mass predictors were WC (8%) and systolic BP (5%) in men and WC (36%) and systolic BP (3%) in women. Conclusion: BMI in general and particularly increased abdominal adiposity (WC as surrogate) seems to account for most of LV mass increase in normotensive individuals, mainly in women. (C) 2008 Elsevier Ireland Ltd. All rights reserved.
Resumo:
Background: Chagas` disease is the illness caused by the protozoan Trypanosoma cruzi and it is still endemic in Latin America. Heart transplantation is a therapeutic option for patients with end-stage Chagas` cardiomyopathy. Nevertheless, reactivation may occur after transplantation, leading to higher morbidity and graft dysfunction. This study aimed to identify risk factors for Chagas` disease reactivation episodes. Methods: This investigation is a retrospective cohort study of all Chagas` disease heart transplant recipients from September 1985 through September 2004. Clinical, microbiologic and histopathologic data were reviewed. Statistical analysis was performed with SPSS (version 13) software. Results: Sixty-four (21.9%) patients with chronic Chagas` disease underwent heart transplantation during the study period. Seventeen patients (26.5%) had at least one episode of Chagas` disease reactivation, and univariate analysis identified number of rejection episodes (p = 0.013) and development of neoplasms (p = 0.040) as factors associated with Chagas` disease reactivation episodes. Multivariate analysis showed that number of rejection episodes (hazard ratio = 1.31; 95% confidence interval [CI]: 1.06 to 1.62; p = 0.011), neoplasms (hazard ratio = 5.07; 95% CI: 1.49 to 17.20; p = 0.009) and use of mycophenolate mofetil (hazard ratio = 3.14; 95% CI: 1.00 to 9.84; p = 0.049) are independent determinants for reactivation after transplantation. Age (p = 0.88), male gender (p = 0.15), presence of rejection (p = 0.17), cytomegalovirus infection (p = 0.79) and mortality after hospital discharge (p = 0.15) showed no statistically significant difference. Conclusions: Our data suggest that events resulting in greater immunosuppression status contribute to Chagas` disease reactivation episodes after heart transplantation and should alert physicians to make an early diagnosis and perform pre-emptive therapy. Although reactivation led to a high rate of morbidity, a low mortality risk was observed.