[meanings Of The Sickening Process For Patients With Systemic Lupus Erythematosus: A Review Of The Literature.]

Systemic lupus erythematosus is an autoimmune disease that causes many psychological repercussions that have been studied through qualitative research. These are considered relevant, since they reveal the amplitude experienced by patients. Given this importance, this study aims to map the qualitative production in this theme, derived from studies of experiences of adult patients of both genders and that had used as a tool a semi-structured interview and/or field observations, and had made use of a sampling by a saturation criterion to determine the number of participants in each study. The survey was conducted in Pubmed, Lilacs, Psycinfo e Cochrane databases, searching productions in English and Portuguese idioms published between January 2005 and June 2012. The 19 revised papers that have dealt with patients in the acute phase of the disease showed themes that were categorized into eight topics that contemplated the experienced process at various stages, from the onset of the disease, extending through the knowledge of the diagnosis and the understanding of the manifestations of the disease, drug treatment and general care, evolution and prognosis. The collected papers also point to the difficulty of understanding, of the patients, on what consists the remission phase, revealing also that this is a clinical stage underexplored by psychological studies.

Elevated Cetp Activity During Acute Phase Of Myocardial Infarction Is Independently Associated With Endothelial Dysfunction And Adverse Clinical Outcome.

Recent data suggests that cholesteryl ester transfer protein (CETP) activity may interact with acute stress conditions via inflammatory-oxidative response and thrombogenesis. We investigated this assumption in patients with ST-elevation myocardial infarction (STEMI). Consecutive patients with STEMI (n = 116) were enrolled <24-h of symptoms onset and were followed for 180 days. Plasma levels of C-reactive protein (CRP), interleukin-2 (IL-2), tumor necrosis factor (TNFα), 8-isoprostane, nitric oxide (NOx) and CETP activity were measured at enrollment (D1) and at fifth day (D5). Flow-mediated dilation (FMD) was assessed by ultrasound and coronary thrombus burden (CTB) was evaluated by angiography. Neither baseline nor the change of CETP activity from D1 to D5 was associated with CRP, IL-2, TNFα, 8-isoprostane levels or CTB. The rise in NOx from D1 to D5 was inferior [3.5(-1; 10) vs. 5.5(-1; 12); p < 0.001] and FMD was lower [5.9(5.5) vs. 9.6(6.6); p = 0.047] in patients with baseline CETP activity above the median value than in their counterparts. Oxidized HDL was measured by thiobarbituric acid reactive substances (TBARS) in isolated HDL particles and increased from D1 to D5, and remaining elevated at D30. The change in TBARS content in HDL was associated with CETP activity (r = 0.72; p = 0.014) and FMD (r = -0.61; p = 0.046). High CETP activity at admission was associated with the incidence of sudden death and recurrent MI at 30 days (OR 12.8; 95% CI 1.25-132; p = 0.032) and 180 days (OR 3.3; 95% CI 1.03-10.7; p = 0.044). An enhanced CETP activity during acute phase of STEMI is independently associated with endothelial dysfunction and adverse clinical outcome.

Evaluation Of The Location Of Capsules Swallowed With Food During The Pharyngeal Phase Triggering In Asymptomatic Adults.

To assess the location of hard gelatin capsules in the pharyngeal phase triggering among asymptomatic adults. The location of the bolus during the pharyngeal phase triggering provides information about the sensorimotor model of the beginning of deglutition onset. To evaluate the location of hard gelatin capsules in the pharyngeal phase triggering among asymptomatic adults. A videofluoroscopy swallowing study was carried out in 60 subjects (14 male and 46 female participants) aged between 27 and 55 years, who were evaluated with hard gelatin capsules #00 and #3 containing barium sulfate, swallowed with liquid food and pudding, in free volume. The first laryngeal elevation movement was the criterion to locate the pharyngeal phase triggering. Statistical analysis was based on the McNemar test. Capsule #3 presented higher percentage of location in the tongue dorsum compared to capsule #00, and capsule #00 presented higher percentage of location in the tongue base and vallecula compared to capsule #3. There was a difference between different capsules swallowed with liquid (p=0.016) and pudding (p=0.037). The capsule size influenced the location of the pharyngeal phase triggering. Smaller capsules started pharyngeal phase in the most anterior region (tongue dorsum) compared to larger capsules.

Molecularly Imprinted Solid Phase Extraction Of Fluconazole From Pharmaceutical Formulations.

This work encompasses a direct and coherent strategy to synthesise a molecularly imprinted polymer (MIP) capable of extracting fluconazole from its sample. The MIP was successfully prepared from methacrylic acid (functional monomer), ethyleneglycoldimethacrylate (crosslinker) and acetonitrile (porogenic solvent) in the presence of fluconazole as the template molecule through a non-covalent approach. The non-imprinted polymer (NIP) was prepared following the same synthetic scheme, but in the absence of the template. The data obtained from scanning electronic microscopy, infrared spectroscopy, thermogravimetric and nitrogen Brunauer-Emmett-Teller plot helped to elucidate the structural as well as the morphological characteristics of the MIP and NIP. The application of MIP as a sorbent was demonstrated by packing it in solid phase extraction cartridges to extract fluconazole from commercial capsule samples through an offline analytical procedure. The quantification of fluconazole was accomplished through UPLC-MS, which resulted in LOD≤1.63×10(-10) mM. Furthermore, a high percentage recovery of 91±10% (n=9) was obtained. The ability of the MIP for selective recognition of fluconazole was evaluated by comparison with the structural analogues, miconazole, tioconazole and secnidazole, resulting in percentage recoveries of 51, 35 and 32%, respectively.

Towards A Deeper Understanding Of Structural Biomass Recalcitrance Using Phase-contrast Tomography.

The development of technological routes to convert lignocellulosic biomass to liquid fuels requires an in-depth understanding of the cell wall architecture of substrates. Essential pretreatment processes are conducted to reduce biomass recalcitrance and usually increase the reactive surface area. Quantitative three-dimensional information about both bulk and surface structural features of substrates needs to be obtained to expand our knowledge of substrates. In this work, phase-contrast tomography (PCT) was used to gather information about the structure of a model lignocellulosic biomass (piassava fibers). The three-dimensional cellular organization of piassava fibers was characterized by PCT using synchrotron radiation. This technique enabled important physical features that describe the substrate piassava fibers to be visualized and quantified. The external surface area of a fiber and internal surface area of the pores in a fiber could be determined separately. More than 96% of the overall surface area available to enzymes was in the bulk substrate. The pore surface area and length exhibited a positive linear relationship, where the slope of this relationship depended on the plant tissue. We demonstrated that PCT is a powerful tool for the three-dimensional characterization of the cell wall features related to biomass recalcitrance. Original and relevant quantitative information about the structural features of the analyzed material were obtained. The data obtained by PCT can be used to improve processing routes to efficiently convert biomass feedstock into sugars.

Breaking Oil-in-water Emulsions Stabilized By Yeast.

Several biotechnological processes can show an undesirable formation of emulsions making difficult phase separation and product recovery. The breakup of oil-in-water emulsions stabilized by yeast was studied using different physical and chemical methods. These emulsions were composed by deionized water, hexadecane and commercial yeast (Saccharomyces cerevisiae). The stability of the emulsions was evaluated varying the yeast concentration from 7.47 to 22.11% (w/w) and the phases obtained after gravity separation were evaluated on chemical composition, droplet size distribution, rheological behavior and optical microscopy. The cream phase showed kinetic stability attributed to mechanisms as electrostatic repulsion between the droplets, a possible Pickering-type stabilization and the viscoelastic properties of the concentrated emulsion. Oil recovery from cream phase was performed using gravity separation, centrifugation, heating and addition of demulsifier agents (alcohols and magnetic nanoparticles). Long centrifugation time and high centrifugal forces (2h/150,000×g) were necessary to obtain a complete oil recovery. The heat treatment (60°C) was not enough to promote a satisfactory oil separation. Addition of alcohols followed by centrifugation enhanced oil recovery: butanol addition allowed almost complete phase separation of the emulsion while ethanol addition resulted in 84% of oil recovery. Implementation of this method, however, would require additional steps for solvent separation. Addition of charged magnetic nanoparticles was effective by interacting electrostatically with the interface, resulting in emulsion destabilization under a magnetic field. This method reached almost 96% of oil recovery and it was potentially advantageous since no additional steps might be necessary for further purifying the recovered oil.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Adaptação do handebol para a prática em cadeira de rodas

Universidade Estadual de Campinas . Faculdade de Educação Física

Tua imensa torcida e bem feliz... da relação torcedor com o clube

Universidade Estadual de Campinas . Faculdade de Educação Física

A ginastica geral na sociedade contemporanea : pespectivas para a Educação Fisica escolar

Universidade Estadual de Campinas. Faculdade de Educação Física

Esportes na natureza e deficiencia visual : uma abordagem pedagogica

Universidade Estadual de Campinas . Faculdade de Educação Física

Modelo para análise do ataque no futebol = : A model to analyze soccer offensive phase

Universidade Estadual de Campinas . Faculdade de Educação Física

Análise quantitativa da distribuição de jogadores de futebol em campo durante jogos oficiais

Universidade Estadual de Campinas. Faculdade de Educação Física

Trajetórias de vida : lembranças, caminhos e constituições dos saberes docentes de professores de Educação Física = Paths and trajectories of life : memories, paths and establishment of teaching knowledge of Physical Education Professors

Universidade Estadual de Campinas . Faculdade de Educação Física

Análise do desempenho em testes de triathlon com diferentes intensidades durante a etapa natação = : Analysis of triathlon trials performance using different intensities during swimming phase

Universidade Estadual de Campinas . Faculdade de Educação Física