1000 resultados para Gallifet, Gaston Alexandre Auguste de (1830-1909) -- Portraits


Relevância:

20.00% 20.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The pupal case of Systropus (Systropus) nitidus Wiedemann reared from an unidentified tipical Limacodidae (Lepidoptera) cocoon is described and illustrated for the first time. Only species of Limacodidae are recorded as host of the immature stages of S. (Systropus). The geographical distribution of S. (Systropus) nitidus is restricted to Brazil, from Pará to Santa Catarina states. This is the first pupal case description and illustration of a Neotropical species of the subgenus Systropus.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Cytogenetic analysis of Astylus antis using mitotic and meiotic cells was performed to characterize the haploid and diploid numbers, sex determination system, chromosome morphology, constitutive heterochromatin distribution pattern and chromosomes carrying nucleolus organizer regions (NORs). Analysis of spermatogonial metaphase cells revealed the diploid number 2n = 18, with mostly metacentric chromosomes. Metaphase I cells exhibited 2n = 8II+Xyp and a parachute configuration of the sex chromosomes. Spermatogonial metaphase cells submitted to C-banding showed the presence of small dots of constitutive heterochromatin in the centromeric regions of nearly all the autosomes and on the short arm of the X chromosome (Xp), as well as an additional band on one of the arms of pair 1. Mitotic cells submitted to double staining with base-specific fluorochromes (DAPI-CMA3) revealed no regions rich in A+T or G+C sequences. Analysis of spermatogonial mitotic cells after sequential Giemsa/AgNO3 staining did not reveal any specific mark on the chromosomes. Meiotic metaphase I cells stained with silver nitrate revealed a strong impregnation associated to the sex chromosomes, and in situ hybridization with an 18S rDNA probe showed ribosomal cistrons in an autosomal bivalent.

Relevância:

20.00% 20.00%

Publicador:

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Context Pheochromocytomas and paragangliomas are genetically heterogeneous neural crest-derived neoplasms. We recently identified germline mutations of the novel transmembrane-encoding gene FP/TMEM127 in familial and sporadic pheochromocytomas consistent with a tumor suppressor effect. Objectives To examine the prevalence and spectrum of FP/TMEM127 mutations in pheochromocytomas and paragangliomas and to test the effect of mutations in vitro. Design, Setting, and Participants We sequenced the FP/TMEM127 gene in 990 individuals with pheochromocytomas and/or paragangliomas, including 898 previously unreported cases without mutations in other susceptibility genes from 8 independent worldwide referral centers between January 2009 and June 2010. A multiplex polymerase chain reaction-based method was developed to screen for large gene deletions in 545 of these samples. Confocal microscopy of 5 transfected mutant proteins was used to determine their subcellular localization. Main Outcome Measures The frequency and type of FP/TMEM127 mutation or deletion was assessed and correlated with clinical variables; the subcellular localization of 5 overexpressed mutants was compared with wild-type FP/TMEM127 protein. Results We identified 19 potentially pathogenic FP/TMEM127 germline mutations in 20 independent families, but no large deletions were detected. All mutation carriers had adrenal tumors, including 7 bilateral (P=2.7 x 10(-4)) and/or with familial disease (5 of 20 samples; P=.005). The median age at disease onset in the FP/TMEM127 mutation group was similar to that of patients without a mutation (41.5 vs 45 years, respectively; P=.54). The most common presentation was that of a single benign adrenal tumor in patients older than 40 years. Malignancy was seen in 1 mutation carrier (5%). Expression of 5 novel FP/TMEM127 mutations in cell lines revealed diffuse localization of the mutant proteins in contrast with the discrete multiorganelle distribution of wild-type TMEM127. Conclusions Germline mutations of FP/TMEM127 were associated with pheochromocytoma but not paraganglioma and occured in an age group frequently excluded from genetic screening algorithms. Disease-associated mutations disrupt intracellular distribution of the FP/TMEM127 protein. JAMA. 2010;304(23):2611-2619 www.jama.com

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Nesta dissertação discutimos os movimentos em torno da temática da apropriação evidenciando o deslocamento do objeto de uso comum para o campo da arte em três movimentos paradigmáticos: o Dadaísmo, o Surrealismo e o Novo Realismo, e seus desdobramentos na arte contemporânea no sentido de legado cultural. Permitimo-nos transitar pelas demais vertentes dos processos de apropriação na arte nova-iorquina e europeia seguindo as propostas da arte com objetos. Investigamos os processos envolvidos nas controvérsias do ready-made, executado por Marcel Duchamp desde 1913, para dar partida ao percurso histórico das manifestações onde ocorre o objet trouvé, a colagem e a assemblagem. Nosso objetivo é responder à pergunta com a qual o filósofo Arthur C. Danto inicia suas investigações filosóficas acerca das apropriações e condições que fazem de um objeto comum uma obra de arte. Para tanto buscamos as teorias de Abrahan Moles e Jean Baudrillard acerca do objeto industrializado e Roland Barthes com as questões metalingüísticas de sua função-signo. Para discutir tais relações da arte com os objetos, recorremos aos textos de Peter Bürger, André Breton, Pierre Restany, Gregory Battcock, Walter Benjamin, Hal Foster e outros. Destacamos alguns trabalhos artísticos, evidenciando o objeto caixa, tratado como um utilitário com forma e finalidade definidas, reafirmando-se como objeto de consumo, no discurso sobre a poética do espaço de Gaston Bachelard. A pesquisa propõe analisar as transformações radicais das estruturas conservadoras da arte e especular sobre o gesto de apropriação dos objetos, com algumas reflexões direcionadas sobre o objeto e a transgressividade da apropriação como experiência de tensão e poder.

Relevância:

20.00% 20.00%

Publicador:

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Trata-se de um ensaio longo sobre toda a poesia de António Franco Alexandre, e seu enquadramento no contexto da poesia portuguesa dos últimos trinta anos do século XX, até ao livro Quatro Caprichos. Discute-se com especial atenção a desconstrução metódica e musical do sentido na poesia de Franco Alexandre.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Mestrado (PES II), Educação Pré-Escolar e Ensino do 1º Ciclo do Ensino Básico, 2014, Universidade dos Açores.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Human Rights as a Way of Life is about the political dimension of Henri Bergson's work, focusing mainly on The Two Sources of Morality and Religion, the last original book by the French philosopher, published in 1932.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

É descrito um caso fatal de infecção por Lagochilascaris sp., — provavelmente Lagochilascaris minor Leiper, 1909 —, com localização pulmonar. O paciente, do sexo feminino, oriundo de Curralinho-Estado do Pará, desenvolveu uma pneumonite grave, que lhe acarretou a morte, por insuficiência respiratória, em pouco menos de três meses. À autópsia, numerosas lesões de natureza exsudativa e granulomatosa podiam ser vistas em ambos os pulmões, indicando tuberculose ou infecção micótica pulmonar. Todavia, quando se procedeu ao exame microscópico, ovos, larvas e até uma fêmea grávida do verme foram encontrados nos tecidos, como causa da doença — sempre no interior de granulomas ou de extensas áreas de necrose. Em quase todos os casos, até agora conhecidos, de lagoquilascaríase humana — cerca de 25 —, o parasito se localizava nos tecidos do pescoço, nos seios da face ou sobre a apófise mastóide. Neste caso, pela primeira vez, um representante do gênero Lagochilascaris é referido em sítio bem distinto do habitual, no hospedeiro humano. O achado, por outro lado, dos diferentes estádios evolutivos do helminto, dispersos pelo parênquima pulmonar, além de mostrar a natureza errática do parasitismo, sugere fortemente a existência de um ciclo pulmonar na lagoquilascaríase humana.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A doença de Chagas se tornou conhecida do mundo científico a partir de 1909. Dadas suas características clínicas, evidências de sua ocorrência até 1909 são fragmentárias. No entanto, uma análise cuidadosa de escritos médicos e leigos, particularmente do século 19, permitiu tirar algumas conclusões acerca da epidemiologia da doença no Brasil, particularmente no Estado de São Paulo. Possivelmente o acesso a obras raras nos permitirá lançar novas luzes sobre o assunto.