911 resultados para Causes and solutions to vulnerability in consumer international relations
Resumo:
This paper exploits a structural time series approach to model the time pattern of multiple and resurgent food scares and their direct and cross-product impacts on consumer response. A structural time series Almost Ideal Demand System (STS-AIDS) is embedded in a vector error correction framework to allow for dynamic effects (VEC-STS-AIDS). Italian aggregate household data on meat demand is used to assess the time-varying impact of a resurgent BSE crisis (1996 and 2000) and the 1999 Dioxin crisis. The VEC-STS-AIDS model monitors the short-run impacts and performs satisfactorily in terms of residuals diagnostics, overcoming the major problems encountered by the customary vector error correction approach.
Resumo:
Taipei City has put a significant effort toward the implementation of green design and green building schemes towards a sustainable eco-city. Although some of the environmental indicators have not indicated significant progress in environmental improvement, implementing the two schemes has obtained considerable results; therefore, the two schemes are on the right path towards promoting a sustainable eco-city. However, it has to be admitted that the two schemes are a rather “technocratic” set of solutions and eco-centric approach. It is suggested that not only the public sector but also the private sector need to put more effort toward implement the schemes, and the government needs to encourage the private sector to adopt the schemes in practice.
Resumo:
Successful and responsible introduction of probiotic and prebiotic products into the worldwide marketplace requires labelling for health benefits that meets consumer needs, adheres to regulatory standards and does not overextend scientific evidence. Regulations differ among countries, but underlying all is an emphasis on scientific credibility of any statements of health benefits. This paper considers the value of different types of evidence offered in substantiation of efficacy and reviews different regulatory approaches to labelling for health claims. Limitations of in vitro, animal and different types of human studies used for efficacy substantiation for probiotics and prebiotics are discussed.
Resumo:
The creation of Wireless Personal Area Networks (WPANs) offers the Consumer Electronics industry a mechanism to truly unwire consumer products, leading to portability and ease of installation as never seen before. WPAN's can offer data-rates exceeding those that are required to convey high quality broadcast video, thus users can easily connect to high quality video for multimedia presentations in education, libraries, advertising, or have a wireless connection at home. There have been many WPAN proposals, but this paper concentrates on ECMA-368 as this standard has the largest industrial and implementers' forum backing. This paper discusses the technology behind ECMA-368, the required numerical bandwidth, buffer memory requirements and implementation considerations while concentrating on supporting all the offered data-rates'.
Resumo:
The aim of this work was to examine a possible association between resistance of two Escherichia coli strains to high hydrostatic pressure and the susceptibility of their cell membranes to pressure-induced damage. Cells were exposed to pressures between 100 and 700 MPa at room temperature (~20C) in phosphate-buffered-saline. In the more pressure-sensitive strain E. coli 8164, loss of viability occurred at pressures between 100 MPa and 300 MPa and coincided with irreversible loss of membrane integrity as indicated by uptake of propidium iodide (PI) and leakage of protein of molecular mass between 9 and 78 kDa from the cells. Protein release increased to a maximum at 400 MPa then decreased, possibly due to intracellular aggregation at the higher pressures. In the pressure-resistant strain E. coli J1, PI was taken up during pressure treatment but not after decompression indicating that cells were able to reseal their membranes. Loss of viability in strain J1 coincided with the transient loss of membrane integrity between approximately 200 MPa and 600 MPa. In E. coli J1 leakage of protein occurred before loss of viability and the released protein was of low molecular mass, between 8 and 11 kDa and may have been of periplasmic origin. In these two strains differences in pressure resistance appeared to be related to differences in the ability of their membranes to withstand disruption by pressure. However it appears that transient loss of membrane integrity during pressure can lead to cell death irrespective of whether cells can reseal their membranes afterwards.
Resumo:
Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.
Resumo:
This paper compares exchange rate pass-through to aggregate prices in the US, Germany and Japan across a number of dimensions. Building on the empirical approaches in the recent literature, our contribution is to perform a thorough sensitivity analysis of pass-through estimates. We find that the econometric method, data frequency and variable proxy employed matter for the precision of details, yet they often agree on some general trends. Thus, pass-through to import prices has declined in the 1990s relative to the 1980s, pass-through to export prices remains country-specific and pass-through to consumer prices is nowadays negligible in all three economies we considered.
Resumo:
The purpose of the paper is to identify and describe differences in cognitive structures between consumer segments with differing levels of acceptance of genetically modified (GM) food. Among a sample of 60 mothers three segments are distinguished with respect to purchase intentions for GM yogurt: non-buyers, maybe-buyers and likely-buyers. A homogeneity test for the elicited laddering data suggests merging maybe- and likely-buyers, yielding two segments termed accepters and rejecters. Still, overlap between the segments’ cognitive structures is considerable, in particular with respect to a health focus in the evaluation of perceived consequences and ambivalence in technology assessment. Distinct differences are found in the assessment of benefits offered by GM food and the importance of values driving product evaluation and thus purchase decisions.
Resumo:
In this study the focus is on transfer in Brussels French, the variety of French spoken in Brussels. The methodology proposed in Jarvis (2000) and Jarvis and Pavlenko (2009) is followed to provide proof for the fact that grammatical collocations such as chercher après "to look for" are the result of contact with the source language, Brussels Dutch.
Resumo:
This article discusses the links between poverty, HIV/AIDS, and barriers to education, based on the first-hand experiences of ‘street children’ in northern Tanzania. Within the context of national levels of poverty, ‘cost-sharing’ in health and education sectors, and the AIDS epidemic, poor families in Tanzania are under considerable pressure, and increasing numbers of girls and boys are consequently seeking a living independently on the streets of towns and cities. My research with street children shows that some children orphaned by AIDS are subject to rejection and exploitation by the extended family after the death of their parent(s). They are exposed to considerable risks of abuse, sexual violence and HIV within the street environment. Here, I discuss the links between poverty, HIV and barriers to education, which compound young people’s vulnerability, and offer some policy recommendations in response to the young people’s experiences.
Resumo:
A novel X-ray rheometer based on a parallel plate geometry is described. This system allows time-resolved X-ray scattering intensity data to be obtained from polymeric samples subjected to shear flow. The range of quantitative structural parameters, such as molecular orientation and inter chain correlations, which can be obtained from the data is highlighted. Examples of the utility of X-ray scattering in examining optically opaque samples and the extraction of 〈P2〉 and 〈P4〉 orientation parameters are given using anisotropic hydroxypropylcellulose solutions as the sample.