970 resultados para Cancer detection


Relevância:

20.00% 20.00%

Publicador:

Resumo:

This study aims to evaluate the frequency and severity of nausea and vomiting using two different instruments and relate them to quality of life (QOL) in patients with cancer receiving antineoplastic treatment. Severity of chemotherapy-induced nausea and vomiting (CINV) was measured by Common Terminology Criteria for Adverse Events (CTCAE) and a numerical scale. QOL was assessed using the Functional Assessment of Cancer Therapy-General questionnaire. Of the 50 patients studied, 60.0% reported nausea (40.0% CTCAE grade 1; 66.7% moderate intensity on numerical scale) and 30.0% reported vomiting (46.7% CTCAE grades 1 and 2, each; 66.7% moderate intensity on numerical scale). CINV did not influence overall QOL. The frequency of CINV was high. There was no association between nausea/vomiting and overall QOL.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Infections of the central nervous systems (CNS) present a diagnostic problem for which an accurate laboratory diagnosis is essential. Invasive practices, such as cerebral biopsy, have been replaced by obtaining a polymerase chain reaction (PCR) diagnosis using cerebral spinal fluid (CSF) as a reference method. Tests on DNA extracted from plasma are noninvasive, thus avoiding all of the collateral effects and patient risks associated with CSF collection. This study aimed to determine whether plasma can replace CSF in nested PCR analysis for the detection of CNS human herpesvirus (HHV) diseases by analysing the proportion of patients whose CSF nested PCR results were positive for CNS HHV who also had the same organism identified by plasma nested PCR. In this study, CSF DNA was used as the gold standard, and nested PCR was performed on both types of samples. Fifty-two patients with symptoms of nervous system infection were submitted to CSF and blood collection. For the eight HHV, one positive DNA result-in plasma and/or CSF nested PCR-was considered an active HHV infection, whereas the occurrence of two or more HHVs in the same sample was considered a coinfection. HHV infections were positively detected in 27/52 (51.9%) of the CSF and in 32/52 (61.5%) of the plasma, difference not significant, thus nested PCR can be performed on plasma instead of CSF. In conclusion, this findings suggest that plasma as a useful material for the diagnosis of cases where there is any difficulty to perform a CSF puncture.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The aim of this study was to develop a methodology using Raman hyperspectral imaging and chemometric methods for identification of pre- and post-blast explosive residues on banknote surfaces. The explosives studied were of military, commercial and propellant uses. After the acquisition of the hyperspectral imaging, independent component analysis (ICA) was applied to extract the pure spectra and the distribution of the corresponding image constituents. The performance of the methodology was evaluated by the explained variance and the lack of fit of the models, by comparing the ICA recovered spectra with the reference spectra using correlation coefficients and by the presence of rotational ambiguity in the ICA solutions. The methodology was applied to forensic samples to solve an automated teller machine explosion case. Independent component analysis proved to be a suitable method of resolving curves, achieving equivalent performance with the multivariate curve resolution with alternating least squares (MCR-ALS) method. At low concentrations, MCR-ALS presents some limitations, as it did not provide the correct solution. The detection limit of the methodology presented in this study was 50μgcm(-2).

Relevância:

20.00% 20.00%

Publicador:

Resumo:

This postdoctoral study on the application of the RIME intervention in women that had undergone mastectomy and were in treatment, aimed to promote psychospiritual and social transformations to improve the quality of life, self-esteem and hope. A total of 28 women participated and were randomized into two groups. Brief Psychotherapy (PB) (average of six sessions) was administered in the Control Group, and RIME (three sessions) and BP (average of five sessions) were applied in the RIME Group. The quantitative results indicated a significant improvement (38.3%) in the Perception of Quality of Life after RIME according to the WHOQOL, compared both to the BP of the Control Group (12.5%), and the BP of the RIME Group (16.2%). There was a significant improvement in Self-esteem (Rosenberg) after RIME (14.6%) compared to the BP of the Control Group (worsened 35.9%), and the BP of the RIME Group (8.3%). The improvement in well-being, considering the focus worked on (Visual Analog Scale), was significant in the RIME Group (bad to good), as well as in the Control Group (unpleasant to good). The qualitative results indicated that RIME promotes creative transformations in the intrapsychic and interpersonal dimensions, so that new meanings and/or new attitudes emerge into the consciousness. It was observed that RIME has more strength of psychic structure, ego strengthening and provides a faster transformation that BP, therefore it can be indicated for crisis treatment in the hospital environment.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

To evaluate pathologic features with implications on surgical radicality in women treated with radical hysterectomy and pelvic lymphadenectomy for cervical cancer stage IA1 with lymph vascular space invasion (LVSI) and stage IA2 by correlating findings in conization and hysterectomy specimens. Women with cervical cancer stage IA1 with LVSI and stage IA2 diagnosed by loop electrosurgical excisional procedure or cold knife conization were treated with radical hysterectomy and pelvic lymphadenectomy from January 1999 to December 2011 in 2 institutions. Fifty patients were enrolled: 40 with stage IA2 and 10 with stage IA1 with LVSI. Median age was 43 (30-67) years. All patients underwent cervical conization for diagnosis (45 loop electrosurgical excisional procedure, 5 cold knife). Lymph vascular space invasion was detected in 15 patients (30%). Two patients had positive pelvic nodes. No parametrial involvement was detected in the entire cohort. Positive margins were present in 35 patients, and residual disease was detected in 22 patients (44%). Positive margins predicted residual disease at radical hysterectomy (P = 0.02). Medium follow-up time was 51 months. One patient developed a pelvic recurrence, and there were no disease-related deaths. Patients with positive margins in cone biopsy specimens have an increased risk of residual disease at radical hysterectomy and require careful evaluation before conservative surgery. Pelvic lymph node evaluation is essential because lymph node metastasis may occur even in early stages. The lack of parametrial invasion in this study reinforces the knowledge that the select group of patients with microinvasive cervical carcinoma stages IA1 LVSI and stage IA2 have a very low risk of parametrial infiltration. Less radical surgery can be carefully considered for these patients.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Focal cryoablation (FC), brachytherapy (B) and active surveillance (AS) were offered to patients diagnosed with very low-risk prostate cancer (VLRPC) in an equal access protocol. Comprehensive validated self-report questionnaires accessed patients' erectile (IIEF-5) and voiding (IPSS) functions, Beck scales measured anxiety (BAI), hopelessness (BHS) and depression (BDI), SF-36 reflected patients' quality of life added to the emotional thermometers including five visual analogue scales (distress, anxiety, depression, anger and need for help). Kruskal-Wallis or ANOVA tests and Spearman's correlations were obtained among groups and studied variables. Thirty patients were included, median follow-up 18 months (15-21). Those on AS (n = 11) were older, presented higher hopelessness (BHS) and lower general health perceptions (SF-36) scores than patients opting for FC (n = 10) and B (n = 9), P = 0.0014, P = 0.0268 and P = 0.0168 respectively. Patients on B had higher IPSS scores compared to those under FC and AC, P = 0.0223. For all 30 included patients, Spearman's correlation (rs ) was very strong between BHS and general health perceptions (rs  = -0.800, P < 0.0001), and weak/moderate between age and BHS (rs  = 0.405, P = 0.026) and age and general health perceptions (rs  = -0.564, P = 0.001). The sample power was >60%. To be considered in patients' counselling and care, current study supports the hypothesis that even VLRPC when untreated undermines psychosocial domains.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

We characterized the functional consequences of intravesical bacillus Calmette-Guérin on the molecular mechanism of the AKT/mTOR signaling pathway in nonmuscle invasive bladder cancer. To our knowledge this has not been reported previously. At age 7 weeks female Fischer 344 rats received 1.5 mg/kg MNU intravesically every other week for 6 weeks. They were randomized at 10 per group to MNU (0.2 ml vehicle), bacillus Calmette-Guérin (10(6) cfu Connaught strain), rapamycin (15 μg/ml) and bacillus Calmette-Guérin plus simultaneous rapamycin, each intravesically for 6 weeks. At week 15 the bladders were collected for histopathology, immunohistochemistry and immunoblot to determine p-AKT, Rictor, Raptor, p-4E-BP1, p-p70S6K1, p-AMPK-α, p-mTOR and p-p53. Papillary carcinoma (pTa) and high grade intraepithelial neoplasia (pTis) predominated in the MNU group while normal urothelium, papillary and flat hyperplasia were more common in treated groups. Nonmuscle invasive bladder cancer treated with bacillus Calmette-Guérin showed suppression of p70S6K1 but not 4E-BP1 phosphorylation. This suggests that 4E-BP1 is regulated differently than p70S6K1, escaping the bacillus Calmette-Guérin action that occurs in a mTOR independent manner. The association of bacillus Calmette-Guérin with rapamycin but not rapamycin monotherapy affected p70S6K1 and 4E-BP1 phosphorylation with no features of in situ carcinoma (pTis). The activation status of p70S6K1 and 4E-BP1 might be used to stratify patients who could benefit from targeting such molecular elements with multitarget/multidrug intravesical therapy. In the future 4E-BP1 might be a worthwhile new target for bacillus Calmette-Guérin refractory nonmuscle invasive bladder cancer.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Purpose. To understand the role of polymorphisms in the LEP (rs7799039 and rs2167270) and LEPR (rs1137101 and rs1137100) genes in DTC susceptibility and their effect on leptin levels. Methods. We studied 153 patients with DTC and 234 controls through TaqMan SNP Genotyping and ELISA, comparing these data to the clinicopathological data of patients with DTC. Results. Patients with AA genotype of rs7799039 had higher levels of serum leptin (9.22 ± 0.98 ng/mL) than those with AG genotype (10.07 ± 0.60 ng/mL; P = 0.005). Individuals with AG genotype of rs2167270 also produced higher serum leptin levels (10.05 ± 0.59 ng/mL) than the subjects with GG genotype (9.52 ± 0.79 ng/mL; P < 0.05). A multivariate logistic regression adjusted for gender, age, and BMI showed that the AG genotype of rs7799039 was an independent risk for DTC (OR, 11.689; P = 0.0183; 95% CI, 1.516-90.119). Similarly, AG and GG genotypes of rs1137101 increased the susceptibility to DTC (OR, 3.747; P = 0.027; 95% CI, 1.161-12.092 and OR, 5.437; P = 0.013; 95% CI, 1.426-20.729). Conclusions. We demonstrated that rs7799039 and rs2167270 polymorphisms modify the serum leptin concentrations in patients with DTC. Furthermore, polymorphisms rs7799039 and rs1137101 increase the risk of DTC development, although they do not correlate with tumor aggressiveness.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Phosphatases have long been regarded as tumor suppressors, however there is emerging evidence for a tumor initiating role for some phosphatases in several forms of cancer. Low Molecular Weight Protein Tyrosine Phosphatase (LMWPTP; acid phosphatase 1 [ACP1]) is an 18 kDa enzyme that influences the phosphorylation of signaling pathway mediators involved in cancer and is thus postulated to be a tumor-promoting enzyme, but neither unequivocal clinical evidence nor convincing mechanistic actions for a role of LMWPTP have been identified. In the present study, we show that LMWPTP expression is not only significantly increased in colorectal cancer (CRC), but also follows a step-wise increase in different levels of dysplasia. Chemical inhibition of LMWPTP significantly reduces CRC growth. Furthermore, downregulation of LMWPTP in CRC leads to a reduced migration ability in both 2D- and 3D-migration assays, and sensitizes tumor cells to the chemotherapeutic agent 5-FU. In conclusion, this study shows that LMWPTP is not only overexpressed in colorectal cancer, but it is correlated with the malignant potential of this cancer, suggesting that this phosphatase may act as a predictive biomaker of CRC stage and represents a rational novel target in the treatment of this disease.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

To determine the effects of radiotherapy on salivary BPIFA expression and to investigate the role of BPIFA in the development of known radiotherapy side effects. Unstimulated whole-mouth saliva was collected from 45 cancer patients (1 week before treatment, during the treatment, and 1 week after completion of radiotherapy) and from 20 controls. BPIFA1 and BPIFA2 expression was detected by western blotting and analyzed along with clinicopathologic data and side effects from the radiotherapy. A facial radiation field was associated with lower salivary flow during and after radiotherapy and correlated with side effects, mainly mucositis. Salivary BPIFA1 expression levels were similar between the control group and the patient group before treatment. On the other hand, BPIFA2 levels were higher in the patient group before treatment compared with the control group. BPIFA concentration was modified by radiotherapy as BPIFA1 levels increased (P = .0081) and BPIFA2 decreased (P < .0001). Higher levels of BPIFA1 were associated with the presence of mucositis (P = .0363) and its severity (P = .0500). The present study found that levels of BPIFA1 and glycosylated forms of BPIFA2 are affected by radiotherapy, suggesting that these proteins may play a role in the oral microenvironment in irradiated patients with head and neck cancer.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A rapid and low cost method to determine Cr(VI) in soils based upon alkaline metal extraction at room temperature is proposed as a semi-quantitative procedure to be performed in the field. A color comparison with standards with contents of Cr(VI) in the range of 10 to 150 mg kg-1 was used throughout. For the different types of soils studied, more than 75% of the fortified soluble Cr(VI) were recovered for all levels of spike tested for both the proposed and standard methods. Recoveries of 83 and 99% were obtained for the proposed and the standard methods, respectively, taking into account the analysis of a heavily contaminated soil sample.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Thyroid nodules are frequent findings, especially when sensitive imaging methods are used. Although thyroid cancer is relatively rare, its incidence is increasing, particularly in terms of small tumors, which have an uncertain clinical relevance. Most patients with differentiated thyroid cancer exhibit satisfactory clinical outcomes when treatment is appropriate, and their mortality rate is similar to that of the overall population. However, relapse occurs in a considerable fraction of these patients, and some patients stop responding to conventional treatment and eventually die from their disease. Therefore, the challenge is how to identify the individuals who require more aggressive disease management while sparing the majority of patients from unnecessary treatments and procedures. We have updated the Brazilian Consensus that was published in 2007, emphasizing the diagnostic and therapeutic advances that the participants, representing several Brazilian university centers, consider most relevant in clinical practice. The formulation of the present guidelines was based on the participants' experience and a review of the relevant literature.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física