Entrepreneurship Education in Basic and Upper Secondary Education – Measurement and Empirical Evidence

The starting point of this study is to direct more attention to the teacher and those entrepreneurship education practices taking place in formal school to find out solutions for more effective promotion of entrepreneurship education. For this objective, the strategy-level aims of entrepreneurship education need to be operationalised into measurable and understandable teacher-level practices. Furthermore, to enable the effective development of entrepreneurship education in basic and upper secondary level education, more knowledge is needed of the state of affairs of entrepreneurship education in teaching. The purpose of the study is to increase the level of understanding of teachers’ entrepreneurship education practices, and through this to develop entrepreneurship education. This study builds on the literature on entrepreneurship education and especially those elements referring to the aims, resources, benefits, methods, and practises of entrepreneurship education. The study comprises five articles highlighting teachers’ role in entrepreneurship education. In the first article the concept of entrepreneurship and the teachers role in reflection upon his/hers approaches to entrepreneurship education are considered. The second article provides a detailed analysis of the process of developing a measurement tool to depict the teachers’ activities in entrepreneurship education. The next three articles highlight the teachers’ role in directing the entrepreneurship education in basic and upper secondary level education. Furthermore, they analyse the relationship between the entrepreneurship education practises and the teachers’ background characteristics. The results of the study suggest a wide range of conclusions and implications. First, in spite of many outspoken aims connected to entrepreneurship education, teachers have not set any aims for themselves. Additionally, aims and results seem to mix. However, it is possible to develop teachers’ target orientation by supporting their reflection skills, and through measurement and evaluation increase their understanding of their own practices. Second, applying a participatory action process it is possible to operationalise teachers’entrepreneurship education practices. It is central to include the practitioners’ perspective in the development of measures to make sure that the concepts and aims of entrepreneurship education are understood. Third, teachers’ demographic or tenure-related background characteristics do not affect their entrepreneurship education practices, but their training related to entrepreneurship education, participation in different school-level or regional planning, and their own capabilities support entrepreneurship education. Fourth, a large number of methods are applied to entrepreneurship education, and the most often used methods were different kinds of discussions, which seem to be an easy, low-threshold way for teachers to include entrepreneurship education regularly in their teaching. Field trips to business enterprises or inviting entrepreneurs to present their work in schools are used fairly seldom. Interestingly, visits outside the school are more common than visitors invited to the school. In line, most of the entrepreneurship education practices take place in a classroom. Therefore it seems to be useful to create and encourage teachers towards more in-depth cooperation with companies (e.g. via joint projects) and to network systematically. Finally, there are plenty of resources available for entrepreneurship education, such as ready-made materials, external stakeholders, support organisations, and learning games, but teachers have utilized them only marginally.

Topical application of a melanotropin analogue to vulgar vitiligo dermo-epidermal minigrafts

Human subjects with active vulgar vitiligo do not respond well to autologous dermo-epidermal minigrafting. Eighteen subjects were treated with the a-melanocyte-stimulating hormone (a-MSH) synthetic analogue [Nle4, D-Phe7]-a-MSH. The hormone (50 µl, 0.4 mM) was applied topically to 30-cm2 lesions in which 29-48 minigrafts had been made. The hormone did not improve the success of the minigrafting and no differences were observed in local or distant repigmentation in treated subjects as compared to the placebo group. Aliquots of 24-h urine concentrated by lyophilization irreversibly darkened toad skins, demonstrating the presence of the analogue. This is the first report of the transdermal delivery of a topically applied melanotropin in living human subjects.

Nutritional status of hemodialysis patients with secondary hyperparathyroidism

The repercussions of secondary hyperparathyroidism on the nutritional status of chronic renal failure patients have not been well established. Therefore, the aim of this study was to compare the nutritional indices of hemodialysis patients with and without secondary hyperparathyroidism. Sixteen hemodialysis patients with serum parathyroid hormone (PTH) levels higher than 420 pg/ml (hyperparathyroidism group) were matched for gender, age and length of dialysis treatment to 16 patients with serum PTH between 64 and 290 pg/ml (control group). The following parameters were assessed: anthropometric indices (body mass index, skinfold thickness, midarm muscle circumference and body fat), 4-day food diaries, protein catabolic rate, biochemical indices (blood urea nitrogen, serum creatinine, albumin, ionized calcium, inorganic phosphorus, serum alkaline phosphatase, PTH, pH and HCO3) and dialysis efficiency. We did not observe differences in the anthropometric indices between the two groups. Only calcium intake was significantly different between groups (307.9 mg/day for the hyperparathyroidism group vs 475.8 mg/day for the control group). Protein catabolic rate tended to be higher in the hyperparathyroidism group compared to the control group (1.3 vs 0.9 g kg-1 day-1; P = 0.08). Except for blood urea nitrogen (86.4 vs 75.7 mg/dl), alkaline phosphatase (175 vs 65 U/l) and PTH (898 vs 155 pg/ml), no other differences were found between groups in the biochemical indices studied. PTH was directly correlated with protein catabolic rate (r = 0.61; P<0.05) and length of dialysis (r = 0.53; P<0.05) only in the hyperparathyroidism group. Considering the indices used, we could not demonstrate the deleterious effect of high PTH levels on the nutritional status of hemodialysis patients. Indirect evidence, however, suggests an action of PTH on protein metabolism.

Gliclazide and bedtime insulin are more efficient than insulin alone for type 2 diabetic patients with sulfonylurea secondary failure

To determine the effects of combined therapy of gliclazide and bedtime insulin on glycemic control and C-peptide secretion, we studied 25 patients with type 2 diabetes and sulfonylurea secondary failure, aged 56.8 ± 8.3 years, with a duration of diabetes of 10.6 ± 6.6 years, fasting plasma glucose of 277.3 ± 64.6 mg/dl and a body mass index of 27.4 ± 4.8 kg/m². Patients were submitted to three therapeutic regimens lasting 2 months each: 320 mg gliclazide (phase 1), 320 mg gliclazide and bedtime NPH insulin (phase 2), and insulin (phase 3). At the end of each period, glycemic and C-peptide curves in response to a mixed meal were determined. During combined therapy, there was a decrease in all glycemic curve values (P<0.01). Twelve patients (48%) reached fasting plasma glucose <140 mg/dl with a significant weight gain of 64.8 kg (43.1-98.8) vs 66.7 kg (42.8-101.4) (P<0.05), with no increase in C-peptide secretion or decrease in HbA1. C-Peptide glucose score (C-peptide/glucose x 100) increased from 0.9 (0.2-2.1) to 1.3 (0.2-4.7) during combined therapy (P<0.01). Despite a 50% increase in insulin doses in phase 3 (12 U (9-30) vs 18 U (11-60); P<0.01) only 3 patients who responded to combined therapy maintained fasting plasma glucose <140 mg/dl (P<0.02). A tendency to a higher absolute increase in C-peptide (0.99 (0.15-2.5) vs 0.6 (0-2.15); P = 0.08) and C-peptide incremental area (2.47 (0.22-6.2) vs 1.2 (0-3.35); P = 0.07) was observed among responders. We conclude that combined therapy resulted in a better glucose response to a mixed meal than insulin alone and should be tried in type 2 diabetic patients before starting insulin monotherapy, despite difficulties in predicting the response.

Circulating forms of parathyroid hormone detected with an immunofluorometric assay in patients with primary hyperparathyroidism and in hyperparathyroidism secondary to chronic renal failure

In patients with uremia, intact parathyroid hormone (PTH) measurement appears to overestimate the biologically active hormone in circulation. The recent description of the accumulation in these patients of a non-intact PTH form measured by the standard immunometric assays, re-opened the question. In this study we submitted serum samples from 7 patients with primary hyperparathyroidism (PHP) and from 10 patients with hyperparathyroidism secondary to chronic renal failure (SHP) to preparative HPLC in order to discriminate the molecular forms measured by our currently used immunofluorometric assay for intact PTH. The elution profile obtained with the HPLC system showed two clearly defined peaks, the first one corresponding to a lower molecular weight form, and the second to the intact PTH (1-84) form. In patients with SHP the area under the curve for the first peak (mean 29.5%, range 20.6 to 40.4%) was significantly greater than that observed for patients with PHP (mean 15.6%, range 5.6 to 21.9%). This confirms previous studies showing accumulation of molecular forms of slightly lower molecular weight, presumably PTH (7-84), in patients with SHP and, to a lesser extent, in patients with PHP. The real necessity of assays that discriminate between these two molecular forms is debatable.

The secondary alcohol and aglycone metabolites of doxorubicin alter metabolism of human erythrocytes

Anthracyclines, a class of antitumor drugs widely used for the treatment of solid and hematological malignancies, cause a cumulative dose-dependent cardiac toxicity whose biochemical basis is unclear. Recent studies of the role of the metabolites of anthracyclines, i.e., the alcohol metabolite doxorubicinol and aglycone metabolites, have suggested new hypotheses about the mechanisms of anthracycline cardiotoxicity. In the present study, human red blood cells were used as a cell model. Exposure (1 h at 37ºC) of intact human red blood cells to doxorubicinol (40 µM) and to aglycone derivatives of doxorubicin (40 µM) induced, compared with untreated red cells: i) a ~2-fold stimulation of the pentose phosphate pathway (PPP) and ii) a marked inhibition of the red cell antioxidant enzymes, glutathione peroxidase (~20%) and superoxide dismutase (~60%). In contrast to doxorubicin-derived metabolites, doxorubicin itself induced a slighter PPP stimulation (~35%) and this metabolic event was not associated with any alteration in glutathione reductase, glutathione peroxidase, catalase or superoxide dismutase activity. Furthermore, the interaction of hemoglobin with doxorubicin and its metabolites induced a significant increase (~22%) in oxygen affinity compared with hemoglobin incubated without drugs. On the basis of the results obtained in the present study, a new hypothesis, involving doxorubicinol and aglycone metabolites, has been proposed to clarify the mechanisms responsible for the doxorubicin-induced red blood cell toxicity.

Measurement of epidermal thickness in a patient with psoriasis by computer-supported image analysis

The aim of the present study was to measure full epidermal thickness, stratum corneum thickness, rete length, dermal papilla widening and suprapapillary epidermal thickness in psoriasis patients using a light microscope and computer-supported image analysis. The data obtained were analyzed in terms of patient age, type of psoriasis, total body surface area involvement, scalp and nail involvement, duration of psoriasis, and family history of the disease. The study was conducted on 64 patients and 57 controls whose skin biopsies were examined by light microscopy. The acquired microscopic images were transferred to a computer and measurements were made using image analysis. The skin biopsies, taken from different body areas, were examined for different parameters such as epidermal, corneal and suprapapillary epidermal thickness. The most prominent increase in thickness was detected in the palmar region. Corneal thickness was more pronounced in patients with scalp involvement than in patients without scalp involvement (t = -2.651, P = 0.008). The most prominent increase in rete length was observed in the knees (median: 491 µm, t = 10.117, P = 0.000). The difference in rete length between patients with a positive and a negative family history was significant (t = -3.334, P = 0.03), being 27% greater in psoriasis patients without a family history. The differences in dermal papilla distances among patients were very small. We conclude that microscope-supported thickness measurements provide objective results.

The role of secondary hyperparathyroidism in left ventricular hypertrophy of patients under chronic hemodialysis

End-stage renal disease (ESRD) patients frequently develop structural cardiac abnormalities, particularly left ventricular hypertrophy (LVH). The mechanisms involved in these processes are not completely understood. In the present study, we evaluated a possible association between parathyroid hormone (PTH) levels and left ventricular mass (LVM) in patients with ESRD. Stable uremic patients on intermittent hemodialysis treatment were evaluated by standard two-dimensional echocardiography and their sera were analyzed for intact PTH. Forty-one patients (mean age 45 years, range 18 to 61 years), 61% males, who had been on hemodialysis for 3 to 186 months, were evaluated. Patients were stratified into 3 groups according to serum PTH: low levels (<100 pg/ml; group I = 10 patients), intermediate levels (100 to 280 pg/ml; group II = 10 patients) and high levels (>280 pg/ml; group III = 21 patients). A positive statistically significant association between LVM index and PTH was identified (r = 0.34; P = 0.03, Pearson's correlation coefficient) in the sample as a whole. In subgroup analyses, we did not observe significant associations in the low and intermediate PTH groups; nevertheless, PTH and LVM index were correlated in patients with high PTH levels (r = 0.62; P = 0.003). LVM index was also inversely associated with hemoglobin (r = -0.34; P = 0.03). In multivariate analysis, after adjustment for age, hemoglobin, body mass index, and blood pressure, the only independent predictor of LVM index was PTH level. Therefore, PTH is an independent predictor of LVH in patients undergoing chronic hemodialysis. Secondary hyperparathyroidism may contribute to the elevated cardiovascular morbidity associated with LVH in ESRD.

Primary and secondary esophageal contractions in patients with gastroesophageal reflux disease

We studied the primary and secondary esophageal peristalsis in 36 patients with heartburn and acid regurgitation and in 14 asymptomatic volunteers. Primary peristalsis was elicited by ten swallows of a 5-mL bolus of water and secondary peristalsis was elicited by intra-esophageal infusion of 5, 10, and 15 mL water, 0.1 N hydrochloric acid and air. Esophageal contractions were measured by an 8-lumen manometric catheter assembly incorporating a 6-cm sleeve device. Contractions were registered at 3, 9, and 15 cm from the upper margin of the sleeve and the infusion was done through a side hole located at 12 cm. Twenty patients had normal endoscopic esophageal examination, 10 with normal (group I) and 10 with abnormal pH-metric examination (group II), and 16 had esophagitis (group III). The amplitude of contractions after swallows was lower (97.8 ± 10.0 mmHg) in the distal esophagus of group III patients than in controls (142.3 ± 14.0 mmHg). Patients of group III had fewer secondary contractions (water: 25% of infusion) than patients of the other groups and controls (67% of infusion). Patients of group III also had a lower amplitude of secondary peristalsis in the distal esophagus (water: 70.1 ± 9.6 mmHg) than controls (129.2 ± 18.2 mmHg). We conclude that patients with esophagitis have an impairment of primary and secondary peristalsis in the distal esophagus.

Secondary prevention of type 1 diabetes mellitus: stopping immune destruction and promoting ß-cell regeneration

Type 1 diabetes mellitus results from a cell-mediated autoimmune attack against pancreatic ß-cells. Traditional treatments involve numerous daily insulin dosages/injections and rigorous glucose control. Many efforts toward the identification of ß-cell precursors have been made not only with the aim of understanding the physiology of islet regeneration, but also as an alternative way to produce ß-cells to be used in protocols of islet transplantation. In this review, we summarize the most recent studies related to precursor cells implicated in the regeneration process. These include embryonic stem cells, pancreas-derived multipotent precursors, pancreatic ductal cells, hematopoietic stem cells, mesenchymal stem cells, hepatic oval cells, and mature ß-cells. There is controversial evidence of the potential of these cell sources to regenerate ß-cell mass in diabetic patients. However, clinical trials using embryonic stem cells, umbilical cord blood or adult bone marrow stem cells are under way. The results of various immunosuppressive regimens aiming at blocking autoimmunity against pancreatic ß-cells and promoting ß-cell preservation are also analyzed. Most of these regimens provide transient and partial effect on insulin requirements, but new regimens are beginning to be tested. Our own clinical trial combines a high dose immunosuppression with mobilized peripheral blood hematopoietic stem cell transplantation in early-onset type 1 diabetes mellitus.

Pamidronate for the treatment of osteoporosis secondary to chronic cholestatic liver disease in Wistar rats

Osteoporosis is a major complication of chronic cholestatic liver disease (CCLD). We evaluated the efficacy of using disodium pamidronate (1.0 mg/kg body weight) for the prevention (Pr) or treatment (Tr) of cholestasis-induced osteoporosis in male Wistar rats: sham-operated (Sham = 12); bile duct-ligated (Bi = 15); bile duct-ligated animals previously treated with pamidronate before and 1 month after surgery (Pr = 9); bile duct-ligated animals treated with pamidronate 1 month after surgery (Tr = 9). Rats were sacrificed 8 weeks after surgery. Immunohistochemical expression of IGF-I and GH receptor was determined in the proximal growth plate cartilage of the left tibia. Histomorphometric analysis was performed in the right tibia and the right femur was used for biomechanical analysis. Bone material volume over tissue volume (BV/TV) was significantly affected by CCLD (Sham = 18.1 ± 3.2 vs Bi = 10.6 ± 2.2%) and pamidronate successfully increased bone volume. However, pamidronate administered in a preventive regimen presented no additional benefit on bone volume compared to secondary treatment (BV/TV: Pr = 39.4 ± 12.0; Tr = 41.2 ± 12.7%). Moreover, the force on the momentum of fracture was significantly reduced in Pr rats (Sham = 116.6 ± 23.0; Bi = 94.6 ± 33.8; Pr = 82.9 ± 22.8; Tr = 92.5 ± 29.5 N; P < 0.05, Sham vs Pr). Thus, CCLD had a significant impact on bone histomorphometric parameters and pamidronate was highly effective in increasing bone mass in CCLD; however, preventive therapy with pamidronate has no advantage regarding bone fragility.

Epidermal growth factor receptor (EGFR) mutations in lung cancer: preclinical and clinical data

Lung cancer leads cancer-related mortality worldwide. Non-small-cell lung cancer (NSCLC), the most prevalent subtype of this recalcitrant cancer, is usually diagnosed at advanced stages, and available systemic therapies are mostly palliative. The probing of the NSCLC kinome has identified numerous nonoverlapping driver genomic events, including epidermal growth factor receptor (EGFR) gene mutations. This review provides a synopsis of preclinical and clinical data on EGFR mutated NSCLC and EGFR tyrosine kinase inhibitors (TKIs). Classic somatic EGFR kinase domain mutations (such as L858R and exon 19 deletions) make tumors addicted to their signaling cascades and generate a therapeutic window for the use of ATP-mimetic EGFR TKIs. The latter inhibit these kinases and their downstream effectors, and induce apoptosis in preclinical models. The aforementioned EGFR mutations are stout predictors of response and augmentation of progression-free survival when gefitinib, erlotinib, and afatinib are used for patients with advanced NSCLC. The benefits associated with these EGFR TKIs are limited by the mechanisms of tumor resistance, such as the gatekeeper EGFR-T790M mutation, and bypass activation of signaling cascades. Ongoing preclinical efforts for treating resistance have started to translate into patient care (including clinical trials of the covalent EGFR-T790M TKIs AZD9291 and CO-1686) and hold promise to further boost the median survival of patients with EGFR mutated NSCLC.

Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

Influence of secondary packing on the freezing time of chiken meat in air blast freezing tunnels

Freezing of poultry cuts in continuous convective air blast tunnels is normally performed with the products protected by Low Density Polyethylene (LDPE) as a primary packaging and using Corrugated Cardboard Boxes (CCB) as secondary packaging. The objective of this work was to investigate the influence of these secondary packaging on the freezing of poultry cuts in continuous convective air blast tunnels. The study was performed by replacing CCB with Perforated Metal Boxes (PMB) in order to remove the packaging thermal resistance. The assays, performed in a industrial plant, demonstrated that CCB used commercially for meat freezing have a high heat transfer resistance. Their replacement with PMB can lead to shorter freezing times and spatially homogeneous freezing. Reductions of up to 45% in the freezing times were observed using PMB. The plateau of the temperature curve, related to the freezing time of free water, was significantly reduced using PMB, which is accepted to lead to better product quality after thawing. As the products were protected by the LDPE films as primary packaging, their appearance were not affected. The results presented in this work indicate that replacing CBB with PMB can be an excellent alternative to reduce freezing time and improve freezing homogeneity in industrial air blast tunnels, which could also be applied to other products.