The Influence Of Body Weight On Sexual Function And Quality Of Life In Women With Polycystic Ovary Syndrome.

To assess sexual function (SF) and quality of life (QOL) in women with polycystic ovary syndrome (PCOS). A cross-sectional study was conducted to assess 56 women with PCOS and 102 control women with regular menstrual cycles. To assess SF and QOL in Brazilian women with PCOS with Female Sexual Function Index (FSFI) and the WHOQOL-bref questionnaires. Women with PCOS had a worse evaluation to arousal, lubrication, satisfaction, pain and total FSFI, and there was no difference in sexual desire and orgasm. Besides, they had a worse evaluation concerning health status than controls. The body mass index was inversely correlated to the QOL, especially to the physical, psychological, environment aspects and self-assessment of QOL, but it did not show correlation to the SF. Women with PCOS had a worse sexual function and self-assessment of health condition in comparison to controls. The body weight as isolated symptom was correlated to the worsening in quality of life, but not with the worsening of sexual function.

Quality Of Life On Arterial Hypertension: Validity Of Known Groups Of Minichal.

Introductions: In the care of hypertension, it is important that health professionals possess available tools that allow evaluating the impairment of the health-related quality of life, according to the severity of hypertension and the risk for cardiovascular events. Among the instruments developed for the assessment of health-related quality of life, there is the Mini-Cuestionario of Calidad de Vida en la Hipertensión Arterial (MINICHAL) recently adapted to the Brazilian culture. Objective: To estimate the validity of known groups of the Brazilian version of the MINICHAL regarding the classification of risk for cardiovascular events, symptoms, severity of dyspnea and target-organ damage. Methods: Data of 200 hypertensive outpatients concerning sociodemographic and clinical information and health-related quality of life were gathered by consulting the medical charts and the application of the Brazilian version of MINICHAL. The Mann-Whitney test was used to compare health-related quality of life in relation to symptoms and target-organ damage. The Kruskal-Wallis test and ANOVA with ranks transformation were used to compare health-related quality of life in relation to the classification of risk for cardiovascular events and intensity of dyspnea, respectively. Results: The MINICHAL was able to discriminate health-related quality of life in relation to symptoms and kidney damage, but did not discriminate health-related quality of life in relation to the classification of risk for cardiovascular events. Conclusion: The Brazilian version of the MINICHAL is a questionnaire capable of discriminating differences on the health‑related quality of life regarding dyspnea, chest pain, palpitation, lipothymy, cephalea and renal damage.Fundamento: No cuidado ao hipertenso, é importante que o profissional de saúde disponha de ferramentas que possibilitem avaliar o comprometimento da qualidade de vida relacionada à saúde, de acordo com a gravidade da hipertensão e o risco para eventos cardiovasculares. Dentre os instrumentos criados para avaliação da qualidade de vida relacionada à saúde, destaca-se o Mini-Cuestionario de Calidad de Vida en la Hipertensión Arterial (MINICHAL), recentemente adaptado para a cultura brasileira. Objetivo: Estimar a validade de grupos conhecidos da versão brasileira do MINICHAL em relação à classificação de risco para eventos cardiovasculares, sintomas, intensidade da dispneia e lesões de órgãos-alvo. Métodos: Foram investigados 200 hipertensos em seguimento ambulatorial, cujos dados sociodemográficos, clínicos e de qualidade de vida relacionada à saúde foram obtidos por meio de consulta ao prontuário e da aplicação da versão brasileira do MINICHAL. O teste de Mann-Whitney foi utilizado para comparar qualidade de vida relacionada à saúde em relação aos sintomas e às lesões de órgãos-alvo. Teste de Kruskal-Wallis e ANOVA com transformação nos ranks foram empregados para comparar qualidade de vida relacionada à saúde em relação à classificação de risco para eventos cardiovasculares e intensidade da dispneia, respectivamente. Resultados: O MINICHAL discriminou qualidade de vida relacionada à saúde em relação aos sintomas e dano renal (lesões de órgãos-alvo), porém não discriminou qualidade de vida relacionada à saúde em relação à classificação de risco para eventos cardiovasculares. Conclusão: A versão brasileira do MINICHAL é um instrumento capaz de discriminar diferenças na qualidade de vida relacionada à saúde em relação aos sintomas de dispneia, precordialgia, palpitação, lipotímia, cefaleia e presença de dano renal.

Quality Of Life Of Coronary Artery Disease Patients After The Implementation Of Planning Strategies For Medication Adherence.

to compare the general and specific health-related quality of life (HRQoL) between the Intervention (IG) and Control (CG) groups of coronary artery disease patients after the implementation of Action Planning and Coping Planning strategies for medication adherence and to verify the relationship between adherence and HRQoL. this was a controlled and randomized study. the sample (n=115) was randomized into two groups, IG (n=59) and CG (n=56). Measures of medication adherence and general and specific HRQoL were obtained in the baseline and after two months of monitoring. the findings showed that the combination of intervention strategies - Action Planning and Coping Planning for medication adherence did not affect the HRQoL of coronary artery disease patients in outpatient monitoring.

Utilização de 1-metilciclopropeno e resfriamento rápido na conservação de pêssegos

Postharvest losses vary among the different vegetable products. However, among fruits and vegetables the losses generally range from 30% to 50%. Thus, this paper aimed the application of 1-methylcycloprene (1-MCP) and fast cooling with forced air (PC) on peaches, in order to estimate their effects in the ripening process of this fruit. Physiological analyses were performed, such as loss of fresh mass, firmness, pH, titratable acidity, soluble solids, ratio and CO2 production, as well as sensorial analyses such as color, texture and flavor. The experiment was divided in two phases. In the first one, concentrations of 30, 60, and 90 nL/L 1-MCP, applied at 0 ºC and 20 ºC, were tested. The fruits treated without 1-MCP were denominated control for both temperatures studied. The second phase was composed by the following treatments: cold storage (CS) or control, cooling with forced air (CFA), cooling with forced air followed by 1-MCP application (CFA + 1-MCP) and 1-MCP application (1-MCP). Among these, the CFA + 1-MCP treatment provided more firmness of the fruits in comparison to the control fruits. The respiratory rate of peaches under CFA and CFA + 1-MCP treatments decreased in comparison to the control fruit respiratory rates.

Otimização da eficiência de limpeza em equipamento de beneficiamento de tomate de mesa

The post-harvesting cleaning process in fresh market tomatoes production is essential to the consumer acceptance, since the degree of dirtiness of the fruits is directly related to its quality. However, the washing stage of the cleaning process of commercial packinghouse demands an excessive water volume, bringing serious environmental concerns. The objective of this work was to compare the cleaning efficiency in two cleaning systems through the evaluation of different operational conditions of the cleaning process, related with the brush rotation, water flow and fruit standing time under the system. It was compared the conventional system utilized in commercial equipment with a system using commercial sprays. The results showed that the cleaning efficiency was not directly related to the water volume used, but to the water pressure, standing time and brushes rotation. Therefore, the use of commercial sprays can bring benefits to the cleaning efficiency, increasing it up to 13%, and to the environmental, decreasing water consumption.

Avaliação de linhas de beneficiamento e impactos de queda na qualidade de caqui Rama Forte

Excessive and inadequate handling of fruits and vegetables provides high incidences of physical damage, consequently, post harvest losses. The main goal of this work was to evaluate the impact magnitude in persimmon packing lines, Rama Forte, and to determine, at the laboratory, its impact limits. For evaluating the critical points it was used an instrumented sphere of 76 mm of diameter (Technmark, Inc, Lansing, USA), which registered the impact magnitude in seven distinctive impact lines located in four packing houses. For determining physical damages, tests were carried out at the laboratory, where fruit drop was related to impact magnitude, physical damage incidence and fruit post harvest losses. At the packing lines, the values found varied from 21 to 87 G on the transfer points and the majority of registered impacts (over 94%) were down 50G. Drops from 20 cm caused an increase in weight losses after six days of storage at room temperature. Drops from 20 and 30 cm caused skin darkness (low L values), associated to a decrease in color intensity (chroma). Impact drop did not affect pulp fruit chemical features.

The relationship between physical aspects of quality of life and extreme levels of regular physical activity in adults

This study aimed to check for any significant differences in perceived quality of life, specifically aspects of a physical nature, among volunteers who are more physically active and those less physically active in a university community. The sample consisted of 1,966 volunteers in a university community in Brazil. To assess physical activity levels, volunteers responded to the International Physical Activity Questionnaire (IPAQ), and to analyse the perception of quality of life they responded to WHOQOL-bref, which is classified into three groups according to level of physical activity, taking into account the metabolic equivalent index (MET) over a full week. For comparison, consideration was given to the first and third tertiles, respectively, namely groups of more and less active students. The results indicated that individuals who engaged in more physical activity had a more positive perception of quality of life compared to those who were less active in physical aspects related to the ability to work, energy for day-to-day activities and locomotion.

Malpighiaceae: correlations between habit, fruit type and basic chromosome number

The family Malpighiaceae presents species with different habits, fruit types and cytological characters. Climbers are considered the most derived habit, followed, respectively, by the shrubby and arboreal ones. The present study examines the relationship between basic chromosome numbers and the derivation of climbing habit and fruit types in Malpighiaceae. A comparison of all the chromosome number reports for Malpighiaceae showed a predominance of chromosome numbers based on x=5 or 10 in the genera of sub-family Malpighioideae, mainly represented by climbers with winged fruits, whereas non-climbing species with non-winged fruits, which predominate in sub-family Byrsonimoideae, had counts based on x=6, which is considered the less derived basic number for the family. Based on such data, confirmed by statistic assays, and on the monophyletic origin of this family, we admit the hypothesis that morphological derivation of habit and fruit is correlated with chromosome basic number variation in the family Malpighiaceae.

Qualidade pós-colheita de caqui 'fuyu' com utilização de diferentes concentrações de cobertura comestível

One of the main objectives of applying edible coatings on fruits surface is to create a protective film to reduce weight loss due to evaporation and transpiration and also to decrease the risk of fruit rot caused by environmental contamination, in order to improve the visual aspect. Therefore, it is possible to increase shelf life, and decrease post harvest losses. Persimmon is a much appreciated fruit, with high potential for export, but sensitive to handling and storage. This study aimed to evaluate the effect of applying the edible coating Megh Wax ECF-124 (18% of active composts, consisting of emulsion of carnauba wax, anionic surfactant, preservative and water) produced by Megh Industry and Commerce Ltda in three different concentrations (25, 50 and 100%) on post harvest quality of 'Fuyu' persimmon stored for 14 days. The attributes evaluated for quality were: firmness, pH, acidity, soluble solids, weight loss and color. The results showed that application of carnauba wax in different concentrations was effective on decreasing weight loss of persimmon cv. Fuyu and maintenance of color aspects. Treatment at lower concentration, 25%, showed lower rate of discharge, but high concentrations showed lower values of mass loss. Carnauba wax application showed a high potential for use on postharvest conservation, and can be applied together with other technologies, helping to maintain quality for export.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Quality of life in patients with ileal pouch for ulcerative colitis

INTRODUCTION:proctocolectomy with ileal pouch-anal anastomosis (IPAA) is the standard surgical procedure for the treatment of ulcerative colitis (UC) and is associated with the prospect of cure. Experience gained over the years has demonstrated the occurrence of a high number of complications as well as bowel disorders that can compromise quality of life (QoL).OBJECTIVE:evaluate QoL in patients with IPAA for ulcerative colitis.PATIENTS AND METHODS:the Inflammatory Bowel Disease Questionnaire (IBDQ) was used to assess QoL in patients with IPAA after its validation in Portuguese.RESULTS:thirty-one patients submitted to IPAA by the same group of professionals were evaluated. QoL was classified as regular in all domains evaluated (intestinal and systemic symptoms and emotional and social aspects). There were no differences in relation to gender, type of pouch or postoperative time. However, elderly patients showed a tendency toward lower scores. Having a professional activity was associated with higher scores in systemic symptoms and social aspects (p < 0.05). Patients with ileostomy showed lower values in the domains of systemic symptoms, emotional and social aspects (p <0.05).CONCLUSION:in all domains assessed, patients with IPAA for UC had QoL classified as regular. Ileostomy and lack of professional activity negatively influenced QoL.

Qualidade de vida e composição corporal : características do envelhecimento bem sucedido = Quality of life and body composition : characteristics of successful aging

Universidade Estadual de Campinas . Faculdade de Educação Física

Possibilidades e limites da avaliação da qualidade de vida : análise dos instrumentos WHOQOL e modelos clássicos de qualidade de vida no trabalho = Possibilities and limits of quality of life assessment : analysis of WHOQOL instruments and quality of work life classical models

Universidade Estadual de Campinas . Faculdade de Educação Física

Quality evaluation of DNA obtained from stored human saliva and its applicability to identification in Forensic Dentistry

PURPOSE: This study evaluated the quality of DNA obtained from stored human saliva and its applicability to human identification. METHODS: The saliva samples of 20 subjects, collected in the form of saliva in natura and from mouth swabs and stored at -20ºC, were analyzed. After 7 days, the DNA was extracted from the 40 saliva samples and subjected to PCR and electrophoresis. After 180 days, the technique was repeated with the 20 swab samples. RESULTS: The first-stage results indicated that DNA was successfully extracted in 97.5% of reactions, 95% of saliva in natura and 100% of swab saliva samples, with no statistically significant difference between the forms of saliva. In the second phase, the result was positive for all 20 analyzed samples (100%). Subsequently, in order to analyze the quality of the DNA obtained from human saliva, the SIX3-2 gene was tested on the 20 mouth swab samples, and the PCR products were digested using the MbO1 restriction enzyme to evaluate polymorphisms in the ADRA-2 gene, with positive results for most samples. CONCLUSION: It was concluded that the quantity and quality of DNA from saliva and the techniques employed are adequate for forensic analysis of DNA.

Bone quality associated with daily intake of coffee: a biochemical, radiographic and histometric study

Caffeine induces loss of calcium and influences the normal development of bone. This study investigated the effects of coffee on bone metabolism in rats by biochemical measurement of calcium, bone densitometry and histometry. Male rats, born of female treated daily with coffee and with coffee intake since born, were anesthetized, subjected to extraction of the upper right incisor, and sacrificed 7, 21 and 42 days after surgery. Blood and urine samples were taken, and their maxilla radiographed and processed to obtain 5-µm-thick semi-serial sections stained with hematoxylin and eosin. The volume and bone quality were estimated using an image-analysis software. The results showed significantly greater amount of calcium in the plasma (9.40 ± 1.73 versus 9.80 ± 2.05 mg%) and urine (1.00 ± 0.50 versus 1.25 ± 0.70 mg/24 h) and significantly less amount in bone (90.0 ± 1.94 versus 86.0 ± 2.12 mg/mg bone), reduced bone mineral density (1.05 ± 0.11 versus 0.65 ± 0.15 mmAL), and lower amount of bone (76.19 ± 1.6 versus 53.41 ± 2.1 %) (ANOVA; p≤0.01) in animals treated with coffee sacrificed after 42 days. It may be concluded that coffee/caffeine intake caused serious adverse effects on calcium metabolism in rats, including increased levels of calcium in the urine and plasma, decreased bone mineral density and lower volume of bone, thus delaying the bone repair process.