982 resultados para Vitis vinifera, Microarray, Fruit development


Relevância:

40.00% 40.00%

Publicador:

Resumo:

Pear fruits cv. 'Blanquilla', at various ripening stages, were studied under impact conditions. A 50-6-g spherical steel indentator, with a radius of curvature of 0-94 cm, was dropped on to the fruit from three heights: 4, 6 and 10 cm (0-0199, 0-0299 and 0-0499 J). The variables measured were analyzed. All variables were observed to be related to the impact energy except impact duration, which was related to the fruit firmness. Bruising correlated with impact energy when considering different heights, but not with any specific variable when studying the impact phenomenon at individual heights; however, there was a clear correlation between impact bruising and firmness. Three bruise shapes were observed, corresponding to preclimacteric, climacteric and postclimacteric fruits; a theory for this response is offered. According to the results, the impact response in postclimacteric pear fruits (with firmness values of less than 25 N, and a maturity index above 55) may be explained by the role played by the skin rather than by the pulp.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

We investigated the feedback regulation of ethylene biosynthesis in tomato (Lycopersicon esculentum) fruit with respect to the transition from system 1 to system 2 ethylene production. The abundance of LE-ACS2, LE-ACS4, and NR mRNAs increased in the ripening fruit concomitant with a burst in ethylene production. These increases in mRNAs with ripening were prevented to a large extent by treatment with 1-methylcyclopropene (MCP), an ethylene action inhibitor. Transcripts for the LE-ACS6 gene, which accumulated in preclimacteric fruit but not in untreated ripening fruit, did accumulate in ripening fruit treated with MCP. Treatment of young fruit with propylene prevented the accumulation of transcripts for this gene. LE-ACS1A, LE-ACS3, and TAE1 genes were expressed constitutively in the fruit throughout development and ripening irrespective of whether the fruit was treated with MCP or propylene. The transcripts for LE-ACO1 and LE-ACO4 genes already existed in preclimacteric fruit and increased greatly when ripening commenced. These increases in LE-ACO mRNA with ripening were also prevented by treatment with MCP. The results suggest that in tomato fruit the preclimacteric system 1 ethylene is possibly mediated via constitutively expressed LE-ACS1A and LE-ACS3 and negatively feedback-regulated LE-ACS6 genes with preexisting LE-ACO1 and LE-ACO4 mRNAs. At the onset of the climacteric stage, it shifts to system 2 ethylene, with a large accumulation of LE-ACS2, LE-ACS4, LE-ACO1, and LE-ACO4 mRNAs as a result of a positive feedback regulation. This transition from system 1 to system 2 ethylene production might be related to the accumulated level of NR mRNA.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

During ripening of grape (Vitis labruscana L. cv Concord) berries, abundance of several proteins increased, coordinately with hexoses, to the extent that these became the predominant proteins in the ovary. These proteins have been identified by N-terminal amino acid-sequence analysis and/or function to be a thaumatin-like protein (grape osmotin), a lipid-transfer protein, and a basic and an acidic chitinase. The basic chitinase and grape osmotin exhibited activities against the principal grape fungal pathogens Guignardia bidwellii and Botrytis cinerea based on in vitro growth assays. The growth-inhibiting activity of the antifungal proteins was substantial at levels comparable to those that accumulate in the ripening fruit, and these activities were enhanced by as much as 70% in the presence of 1 m glucose, a physiological hexose concentration in berries. The simultaneous accumulation of the antifungal proteins and sugars during berry ripening was correlated with the characteristic development of pathogen resistance that occurs in fruits during ripening. Taken together, accumulation of these proteins, in combination with sugars, appears to constitute a novel, developmentally regulated defense mechanism against phytopathogens in the maturing fruit.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

Cover title.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

Anterior gradient-2 protein was identified using proteomic technologies as a p53 inhibitor which is overexpressed in human cancers, and this protein presents a novel pro-oncogenic target with which to develop diagnostic assays for biomarker detection in clinical tissue. Combinatorial phage-peptide libraries were used to select 12 amino acid polypeptide aptamers toward anterior gradient-2 to determine whether methods can be developed to affinity purify the protein from clinical biopsies. Selecting phage aptamers through four rounds of screening on recombinant human anterior gradient-2 protein identified two classes of peptide ligand that bind to distinct epitopes on anterior gradient-2 protein in an immunoblot. Synthetic biotinylated peptide aptamers bound in an ELISA format to anterior gradient-2, and substitution mutagenesis further minimized one polypeptide aptamer to a hexapeptide core. Aptamers containing this latter consensus sequence could be used to affinity purify to homogeneity human anterior gradient-2 protein from a single clinical biopsy. The spotting of a panel of peptide aptamers onto a protein microarray matrix could be used to quantify anterior gradient-2 protein from crude clinical biopsy lysates, providing a format for quantitative screening. These data highlight the utility of peptide combinatorial libraries to acquire rapidly a high-affinity ligand that can selectively bind a target protein from a clinical biopsy and provide a technological approach for clinical biomarker assay development in an aptamer microarray format.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

Background The Grooved Carpet shell clam Ruditapes decussatus is the autochthonous European clam and the most appreciated from a gastronomic and economic point of view. The production is in decline due to several factors such as Perkinsiosis and habitat invasion and competition by the introduced exotic species, the manila clam Ruditapes philippinarum. After we sequenced R. decussatus transcriptome we have designed an oligo microarray capable of contributing to provide some clues on molecular response of the clam to Perkinsiosis. Results A database consisting of 41,119 unique transcripts was constructed, of which 12,479 (30.3%) were annotated by similarity. An oligo-DNA microarray platform was then designed and applied to profile gene expression in R. decussatus heavily infected by Perkinsus olseni. Functional annotation of differentially expressed genes between those two conditionswas performed by gene set enrichment analysis. As expected, microarrays unveil genes related with stress/infectious agents such as hydrolases, proteases and others. The extensive role of innate immune system was also analyzed and effect of parasitosis upon expression of important molecules such as lectins reviewed. Conclusions This study represents a first attempt to characterize Ruditapes decussatus transcriptome, an important marine resource for the European aquaculture. The trancriptome sequencing and consequent annotation will increase the available tools and resources for this specie, introducing the possibility of high throughput experiments such as microarrays analysis. In this specific case microarray approach was used to unveil some important aspects of host-parasite interaction between the Carpet shell clam and Perkinsus, two non-model species, highlighting some genes associated with this interaction. Ample information was obtained to identify biological processes significantly enriched among differentially expressed genes in Perkinsus infected versus non-infected gills. An overview on the genes related with the immune system on R. decussatus transcriptome is also reported.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

The lack of pear-compatible rootstocks in Brazil calls for the application of classical genetic techniques. Therefore, in order to obtain select suitable material, the search for genetic segregation must be continuous, being used as alternative scion cultivars. This study aims to assess fruit set, number of seeds, fruit weight and fruit diameter according to crosses between pear cultivars. The trial was carried out from September 2008 to February 2009 in a commercial orchard in the city of Vacaria/RS, Brazil. For the pollination process, pollen was extracted from flowers at full-white stage in the same orchard. The cultivars used were 'Packham's Triumph' and 'Clapps Favorite'. The crossings were defined as: open pollination; selfpollination of 'Packham's Triumph' and 'Packham's Triumph' × 'Clapps Favorite'. The pollinations were done manually in flowers at full-white stage, which were opened, emasculated and then pollinated. Each pollinated flower was then isolated with a fine nylon bag. Open pollination and cross pollination between 'Packham's Triumph' × 'Clapps Favorite' provided higher fruit set (17 and 18%, respectively). Fruit weight and diameter did not differ between treatments. Open pollination provided fruits with a higher number of seeds.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Guarana seeds have the highest caffeine concentration among plants accumulating purine alkaloids, but in contrast with coffee and tea, practically nothing is known about caffeine metabolism in this Amazonian plant. In this study, the levels of purine alkaloids in tissues of five guarana cultivars were determined. Theobromine was the main alkaloid that accumulated in leaves, stems, inflorescences and pericarps of fruit, while caffeine accumulated in the seeds and reached levels from 3.3% to 5.8%. In all tissues analysed, the alkaloid concentration, whether theobromine or caffeine, was higher in young/immature tissues, then decreasing with plant development/maturation. Caffeine synthase activity was highest in seeds of immature fruit. A nucleotide sequence (PcCS) was assembled with sequences retrieved from the EST database REALGENE using sequences of caffeine synthase from coffee and tea, whose expression was also highest in seeds from immature fruit. The PcCS has 1083bp and the protein sequence has greater similarity and identity with the caffeine synthase from cocoa (BTS1) and tea (TCS1). A recombinant PcCS allowed functional characterization of the enzyme as a bifunctional CS, able to catalyse the methylation of 7-methylxanthine to theobromine (3,7-dimethylxanthine), and theobromine to caffeine (1,3,7-trimethylxanthine), respectively. Among several substrates tested, PcCS showed higher affinity for theobromine, differing from all other caffeine synthases described so far, which have higher affinity for paraxanthine. When compared to previous knowledge on the protein structure of coffee caffeine synthase, the unique substrate affinity of PcCS is probably explained by the amino acid residues found in the active site of the predicted protein.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Background: The tomato (Solanum lycopersicum L.) plant is both an economically important food crop and an ideal dicot model to investigate various physiological phenomena not possible in Arabidopsis thaliana. Due to the great diversity of tomato cultivars used by the research community, it is often difficult to reliably compare phenotypes. The lack of tomato developmental mutants in a single genetic background prevents the stacking of mutations to facilitate analysis of double and multiple mutants, often required for elucidating developmental pathways. Results: We took advantage of the small size and rapid life cycle of the tomato cultivar Micro-Tom (MT) to create near-isogenic lines (NILs) by introgressing a suite of hormonal and photomorphogenetic mutations (altered sensitivity or endogenous levels of auxin, ethylene, abscisic acid, gibberellin, brassinosteroid, and light response) into this genetic background. To demonstrate the usefulness of this collection, we compared developmental traits between the produced NILs. All expected mutant phenotypes were expressed in the NILs. We also created NILs harboring the wild type alleles for dwarf, self-pruning and uniform fruit, which are mutations characteristic of MT. This amplified both the applications of the mutant collection presented here and of MT as a genetic model system. Conclusions: The community resource presented here is a useful toolkit for plant research, particularly for future studies in plant development, which will require the simultaneous observation of the effect of various hormones, signaling pathways and crosstalk.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Background: In the tephritids Ceratitis, Bactrocera and Anastrepha, the gene transformer provides the memory device for sex determination via its auto-regulation; only in females is functional Tra protein produced. To date, the isolation and characterisation of the gene transformer-2 in the tephritids has only been undertaken in Ceratitis, and it has been shown that its function is required for the female-specific splicing of doublesex and transformer pre-mRNA. It therefore participates in transformer auto-regulatory function. In this work, the characterisation of this gene in eleven tephritid species belonging to the less extensively analysed genus Anastrepha was undertaken in order to throw light on the evolution of transformer-2. Results: The gene transformer-2 produces a protein of 249 amino acids in both sexes, which shows the features of the SR protein family. No significant partially spliced mRNA isoform specific to the male germ line was detected, unlike in Drosophila. It is transcribed in both sexes during development and in adult life, in both the soma and germ line. The injection of Anastrepha transformer-2 dsRNA into Anastrepha embryos caused a change in the splicing pattern of the endogenous transformer and doublesex pre-mRNA of XX females from the female to the male mode. Consequently, these XX females were transformed into pseudomales. The comparison of the eleven Anastrepha Transformer-2 proteins among themselves, and with the Transformer-2 proteins of other insects, suggests the existence of negative selection acting at the protein level to maintain Transformer-2 structural features. Conclusions: These results indicate that transformer-2 is required for sex determination in Anastrepha through its participation in the female-specific splicing of transformer and doublesex pre-mRNAs. It is therefore needed for the auto-regulation of the gene transformer. Thus, the transformer/transfomer-2 > doublesex elements at the bottom of the cascade, and their relationships, probably represent the ancestral state ( which still exists in the Tephritidae, Calliphoridae and Muscidae lineages) of the extant cascade found in the Drosophilidae lineage ( in which tra is just another component of the sex determination gene cascade regulated by Sex-lethal). In the phylogenetic lineage that gave rise to the drosophilids, evolution co-opted for Sex-lethal, modified it, and converted it into the key gene controlling sex determination.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Background: Cancer shows a great diversity in its clinical behavior which cannot be easily predicted using the currently available clinical or pathological markers. The identification of pathways associated with lymph node metastasis (N+) and recurrent head and neck squamous cell carcinoma (HNSCC) may increase our understanding of the complex biology of this disease. Methods: Tumor samples were obtained from untreated HNSCC patients undergoing surgery. Patients were classified according to pathologic lymph node status (positive or negative) or tumor recurrence (recurrent or non-recurrent tumor) after treatment (surgery with neck dissection followed by radiotherapy). Using microarray gene expression, we screened tumor samples according to modules comprised by genes in the same pathway or functional category. Results: The most frequent alterations were the repression of modules in negative lymph node (N0) and in non-recurrent tumors rather than induction of modules in N+ or in recurrent tumors. N0 tumors showed repression of modules that contain cell survival genes and in non-recurrent tumors cell-cell signaling and extracellular region modules were repressed. Conclusions: The repression of modules that contain cell survival genes in N0 tumors reinforces the important role that apoptosis plays in the regulation of metastasis. In addition, because tumor samples used here were not microdissected, tumor gene expression data are represented together with the stroma, which may reveal signaling between the microenvironment and tumor cells. For instance, in non-recurrent tumors, extracellular region module was repressed, indicating that the stroma and tumor cells may have fewer interactions, which disable metastasis development. Finally, the genes highlighted in our analysis can be implicated in more than one pathway or characteristic, suggesting that therapeutic approaches to prevent tumor progression should target more than one gene or pathway, specially apoptosis and interactions between tumor cells and the stroma.