1000 resultados para The Lusitanian


Relevância:

20.00% 20.00%

Publicador:

Resumo:

This paper discusses the claim of the situatedness of research in both theoretical and applied linguistics and some of its implications and argues that it is linked to the performativity of all assertions, including scientific ones. More importantly, I argue that it is the regressive infinity of performativity that makes inevitable the passage from presumably 'dispassionate' research to militancy.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Aflatoxins are hepatotoxic metabolites produced by Aspergillus flavus and A. parasiticus on a number of agricultural commodities. This research was carried out to evaluate the ability of thermolysed and active Saccharomyces cerevisiae to attenuate liver damage caused by aflatoxin. Diets were prepared containing 0 aflatoxin; 400 mug kg-1 aflatoxin; 400 mug kg-1 aflatoxin plus 1% of dehydrated active yeast, and 400 mug kg-1 aflatoxin plus 1% of thermolysed yeast. A bioassay with Wistar rats was conducted for 28 days, and body organs were weighted and analyses of the liver tissue of the animals were performed. The relative weight of heart, kidneys and liver from animals submitted to the different treatments did not show any difference, and liver tissue of animals feeding on the aflatoxin-free diet was adopted as a toxicity-free pattern. Hepatic tissue of animals feeding on diets containing 400 mug kg-1 aflatoxin or the diet supplemented with 1% thermolysed yeast showed clear signs of toxicity and damage. Hepatic tissue of animals feeding on the diet containing 1% of dehydrated active yeast showed less toxicity signs and damage than those receiving the diet containing 400 mug kg-1 aflatoxin. Active, dehydrated yeast had the ability to reduce toxic effects caused by aflatoxin, but thermolysed yeast was not able to alleviate the effects of aflatoxin toxicity.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

cDNA arrays are a powerful tool for discovering gene expression patterns. Nylon arrays have the advantage that they can be re-used several times. A key issue in high throughput gene expression analysis is sensitivity. In the case of nylon arrays, signal detection can be affected by the plastic bags used to keep membranes humid. In this study, we evaluated the effect of five types of plastics on the radioactive transmittance, number of genes with a signal above the background, and data variability. A polyethylene plastic bag 69 μm thick had a strong shielding effect that blocked 68.7% of the radioactive signal. The shielding effect on transmittance decreased the number of detected genes and increased the data variability. Other plastics which were thinner gave better results. Although plastics made from polyvinylidene chloride, polyvinyl chloride (both 13 μm thick) and polyethylene (29 and 7 μm thick) showed different levels of transmittance, they all gave similarly good performances. Polyvinylidene chloride and polyethylene 29 mm thick were the plastics of choice because of their easy handling. For other types of plastics, it is advisable to run a simple check on their performance in order to obtain the maximum information from nylon cDNA arrays.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

This work investigated the cytotoxic and genotoxic potential of water from the River Paraíba do Sul (Brazil) using Allium cepa roots. An anatomo-morphological parameter (root length), mitotic indices, and frequency of micronuclei were analysed. Eight bulbs were chosen at random for treatment for 24 to 120 hours with the River water collected in the years of 2005 and 2006 from sites in the cities of Tremembé and Aparecida (São Paulo state, Brazil). Daily measurements of the length of the roots grown from each bulb were carried out throughout the experiment. Mitotic index (MI) and frequency of micronuclei (MN) were determined for 2000 cells per root, using 3-5 root tips from other bulbs (7-10). Only in the roots treated with samples of the River water collected in 2005 in Tremembé city was there a decrease in the root length growth compared to the respective control. However, a reduction in MI values was verified for both sites analysed for that year. Considering the data involving root length growth and especially MI values, a cytotoxic potential is suggested for the water of the River Paraíba do Sul at Tremembé and Aparecida, in the year of 2005. On the other hand, since in this year the MN frequency was not affected with the river water treatments, genotoxicity is not assumed for the river water sampled at the aforementioned places.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Low temperatures negatively impact the metabolism of orange trees, and the extent of damage can be influenced by the rootstock. We evaluated the effects of low nocturnal temperatures on Valencia orange scions grafted on Rangpur lime or Swingle citrumelo rootstocks. We exposed six-month-old plants to night temperatures of 20ºC and 8ºC under controlled conditions. After decreasing the temperature to 8ºC, there were decreases in leaf CO2 assimilation, stomatal conductance, mesophyll conductance and CO2 concentration in the chloroplasts, in plant hydraulic conductivity and in the maximum electron transport rate driven ribulose-1,5-bisphosphate (RuBP) regeneration in plants grafted on both rootstocks. However, the effects of low night temperature were more severe in plants grafted on Rangpur rootstock, which also presented reduction in the maximum rate of RuBP carboxylation and in the maximum quantum efficiency of the PSII. In general, irreversible damage due to night chilling was found in the photosynthetic apparatus of plants grafted on Rangpur lime. Low night temperatures induced similar changes in the antioxidant metabolism, preventing oxidative damage in citrus leaves on both rootstocks. As photosynthesis is linked to plant growth, our findings indicate that the rootstock may improve the performance of citrus trees in environments with low night temperatures, with Swingle rootstock improving the photosynthetic acclimation in leaves of orange plants.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The unusual development of branches along the stem of Euterpe edulis is described for the first time. Branches originated at 2 to 190 cm from the ground. Ramified individuals and branches were able to produce reproductive structures and some branches produced roots. A plausible cause for the observed anomaly could be genetic problems due to small population sizes. The better agreement of this process can have a positive effect in the harvest of the heart of palm through the artificial induction of sprouts, what would prevent the death of the individual.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Objective: To review the literature about the use of atypical antipsychotics in the treatment of pathological aggression in children and adolescents. Method: The databases MEDLINE, SciELO, and LILACS were searched for publications in Portuguese or English from 1992 to August 2011 using the following keywords: mental disease, child, adolescent, treatment, atypical antipsychotic, aggressive behavior, aggression, and violent behavior. Results: Sixty-seven studies of good methodological quality and clinical interest and relevance were identified. Studies including children and adolescents were relatively limited, because few atypical antipsychotics have been approved by the Food and Drug Administration (FDA). All the medications included in this review (risperidone, olanzapine, quetiapine, ziprasidone, aripiprazole and clozapine) have some effectiveness in treating aggression in children and adolescents, and choices should be based on clinical indications and side effects. Conclusions: There are few studies about the effectiveness and safety of atypical antipsychotics for the pediatric population, and further randomized controlled studies with larger groups of patients and more diagnostic categories, such as severe conduct disorder and oppositional defiant disorder, should be conducted to confirm the results reported up to date and to evaluate the impact of long-term use.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

In 2004, Costa-Santos and cols. reported 24 patients from 19 Brazilian families with 17α-hydroxylase deficiency and showed that p.W406R and p.R362C corresponded to 50% and 32% of CYP17A1 mutant alleles, respectively. The present report describes clinical and molecular data of six patients from three inbred Brazilian families with 17α-hydroxlyse deficiency. All patients had hypogonadism, amenorrhea and hypertension at diagnosis. Two sisters were found to be 46,XY with both gonads palpable in the inguinal region. All patients presented hypergonadotrophic hypogonadism, with high levels of ACTH (> 104 ng/mL), suppressed plasmatic renin activity, low levels of potassium (< 2.8 mEq/L) and elevated progesterone levels (> 4.4 ng/mL). Three of them, including two sisters, were homozygous for p.W406R mutation and the other three (two sisters and one cousin) were homozygous for p.R362C. The finding of p.W406R and p.R362C in the CYP17A1 gene here reported in additional families, confirms them as the most frequent mutations causing complete combined 17α-hydroxylase/17,20-lyase deficiency in Brazilian patients.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

X-linked adrenoleukodystrophy (X-ALD) is an inherited disease with clinical heterogeneity varying from presymptomatic individuals to rapidly progressive cerebral ALD forms. This disease is characterized by increased concentration of very long chain fatty acids (VLCFAs) in plasma and in adrenal, testicular and nervous tissues. Affected individuals can be classified in different clinical settings, according to phenotypic expression and age at onset of initial symptoms. Molecular defects in X-ALD individuals usually result from ABCD1 gene mutations. In the present report we describe clinical data and the ABCD1 gene study in two boys affected with the childhood cerebral form that presented with different symptomatic manifestations at diagnosis. In addition, their maternal grandfather had been diagnosed with Addison's disease indicating phenotypic variation for X-ALD within this family. The mutation p.Trp132Ter was identified in both male patients; additionally, three females, out of eleven family members, were found to be heterozygous after screening for this mutation. In the present report, the molecular analysis was especially important since one of the heterozygous females was in first stages of pregnancy. Therefore, depending on the fetus outcome, if male and p.Trp132Ter carrier, storage of the umbilical cord blood should be recommended as hematopoietic stem cell transplantation could be considered as an option for treatment in the future.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Multiple endocrine neoplasia type 1 (MEN1) is an autosomal dominant hereditary cancer syndrome characterized mostly by parathyroid, enteropancreatic, and anterior pituitary tumors. We present a case of an 8-year-old boy referred because of hypoglycemic attacks. His diagnosis was pancreatic insulinoma. Paternal grandmother died due to repeated gastroduodenal ulcerations and a paternal aunt presented similar manifestations. At a first evaluation, the father presented only gastric ulceration but subsequently developed hyperparathyroidism and lung carcinoid tumor. During almost 15 years of follow-up, three brothers and the index case presented hyperparathyroidism and hyperprolactinemia. Molecular study showed a G to A substitution in intron 4, at nine nucleotides upstream of the splicing acceptor site, causing a splicing mutation. All affected members of the family have the same mutation. Paternal grandmother and aunt were not studied and the mother does not carry any mutation. MEN1 is a rare condition that requires permanent medical assistance. Early clinical and genetic identification of affected individuals is essential for their own surveillance and also for genetic counseling.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Type II 3β-hydroxysteroid dehydrogenase/Δ5-Δ4-isomerase (3β-HSD2), encoded by the HSD3B2 gene, is a key enzyme involved in the biosynthesis of all the classes of steroid hormones. Deleterious mutations in the HSD3B2 gene cause the classical deficiency of 3β-HSD2, which is a rare autosomal recessive disease that leads to congenital adrenal hyperplasia (CAH). CAH is the most frequent cause of ambiguous genitalia and adrenal insufficiency in newborn infants with variable degrees of salt losing. Here we report the molecular and structural analysis of the HSD3B2 gene in a 46,XY child, who was born from consanguineous parents, and presented with ambiguous genitalia and salt losing. The patient carries a homozygous nucleotide c.665C>A change in exon 4 that putatively substitutes the proline at codon 222 for glutamine. Molecular homology modeling of normal and mutant 3β-HSD2 enzymes emphasizes codon 222 as an important residue for the folding pattern of the enzyme and validates a suitable model for analysis of new mutations.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

OBJECTIVE: Evaluate the efficacy of cumulative doses (CDs) of 131I-iodide therapy (RIT) in differentiated thyroid cancer (DTC). SUBJECTS AND METHODS: The probability of progressive disease according to CDs was evaluated in patients < 45 years old and > 45 years old and correlated to tumor-node-metastasis (TNM), thyroglobulin values, histological types and variants, age, and zduration of the disease. RESULTS: At the end of a follow-up period of 69 ± 56 months, 85 out of 150 DTC patients submitted to fixed doses RIT had no evidence of disease, 47 had stable disease and 18 had progressive disease. Higher CDs were used in the more aggressive variants (p < 0.0001), higher TNM stages (p < 0.0001), and follicular carcinomas (p = 0.0034). Probability of disease progression was higher with CDs > 600 mCi in patients > 45 years old and with CDs > 800 mCi in patients < 45 years. CONCLUSION: Although some patients may still respond to high CDs, the impact of further RIT should be carefully evaluated and other treatment strategies may be warranted.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

FISH has been used as a complement to classical cytogenetics in the detection of mosaicism in sex chromosome anomalies. The aim of this study is to describe three cases in which the final diagnosis could only be achieved by FISH. Case 1 was an 8-year-old 46,XY girl with normal female genitalia referred to our service because of short stature. FISH analysis of lymphocytes with probes for the X and Y centromeres identified a 45,X/46,X,idic(Y) constitution, and established the diagnosis of Turner syndrome. Case 2 was a 21-month-old 46,XY boy with genital ambiguity (penile hypospadias, right testis, and left streak gonad). FISH analysis of lymphocytes and buccal smear identified a 45,X/46,XY karyotype, leading to diagnosis of mixed gonadal dysgenesis. Case 3 was a 47,XYY 19-year-old boy with delayed neuromotor development, learning disabilities, psychological problems, tall stature, small testes, elevated gonadotropins, and azoospermia. FISH analysis of lymphocytes and buccal smear identified a 47,XYY/48,XXYY constitution. Cases 1 and 2 illustrate the phenotypic variability of the 45,X/46,XY mosaicism, and the importance of detection of the 45,X cell line for proper management and follow-up. In case 3, abnormal gonadal function could be explained by the 48,XXYY cell line. The use of FISH in clinical practice is particularly relevant when classical cytogenetic analysis yields normal or uncertain results in patients with features of sex chromosome aneuploidy. Arq Bras Endocrinol Metab. 2012;56(8):545-51

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Deficiency of the enzyme P450 oxidoreductase is a rare form of congenital adrenal hyperplasia with characteristics of combined and partial impairments in steroidogenic enzyme activities, as P450 oxidoreductase transfers electrons to CYP21A2, CYP17A1, and CYP19A1. It results in disorders of sex development and skeletal malformations similar to Antley-Bixley syndrome. We report the case of a 9-year-old girl who was born with virilized genitalia (Prader stage V), absence of palpable gonads, 46,XX karyotype, and hypergonadotropic hypogonadism. During the first year of life, ovarian cyst, partial adrenal insufficiency, and osteoarticular changes, such as mild craniosynostosis, carpal and tarsal synostosis, and limited forearm pronosupination were observed. Her mother presented severe virilization during pregnancy. The molecular analysis of P450 oxidoreductase gene revealed compound heterozygosis for the nonsense p.Arg223*, and the novel missense p.Met408Lys, inherited from the father and the mother, respectively. Arq Bras Endocrinol Metab. 2012;56(8):578-85