969 resultados para Optimized using


Relevância:

20.00% 20.00%

Publicador:

Resumo:

Inductively Coupled Plasma Optical Emission Spectrometry was used to determine Ca, Mg, Mn, Fe, Zn and Cu in samples of processed and natural coconut water. The sample preparation consisted in a filtration step followed by a dilution. The analysis was made employing optimized instrumental parameters and the results were evaluated using methods of Pattern Recognition. The data showed common concentration values for the analytes present in processed and natural samples. Principal Component Analysis (PCA) and Hierarchical Cluster Analysis (HCA) indicated that the samples of different kinds were statistically different when the concentrations of all the analytes were considered simultaneously.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A base-cutter represented for a mechanism of four bars, was developed using the Autocad program. The normal force of reaction of the profile in the contact point was determined through the dynamic analysis. The equations of dynamic balance were based on the laws of Newton-Euler. The linkage was subject to an optimization technique that considered the peak value of soil reaction force as the objective function to be minimized while the link lengths and the spring constant varied through a specified range. The Algorithm of Sequential Quadratic Programming-SQP was implemented of the program computational Matlab. Results were very encouraging; the maximum value of the normal reaction force was reduced from 4,250.33 to 237.13 N, making the floating process much less disturbing to the soil and the sugarcane rate. Later, others variables had been incorporated the mechanism optimized and new otimization process was implemented .

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Size distributions in woody plant populations have been used to assess their regeneration status, assuming that size structures with reverse-J shapes represent stable populations. We present an empirical approach of this issue using five woody species from the Cerrado. Considering count data for all plants of these five species over a 12-year period, we analyzed size distribution by: a) plotting frequency distributions and their adjustment to the negative exponential curve and b) calculating the Gini coefficient. To look for a relationship between size structure and future trends, we considered the size structures from the first census year. We analyzed changes in number over time and performed a simple population viability analysis, which gives the mean population growth rate, its variance and the probability of extinction in a given time period. Frequency distributions and the Gini coefficient were not able to predict future trends in population numbers. We recommend that managers should not use measures of size structure as a basis for management decisions without applying more appropriate demographic studies.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

PURPOSE: To evaluate the sensitivity and specificity of machine learning classifiers (MLCs) for glaucoma diagnosis using Spectral Domain OCT (SD-OCT) and standard automated perimetry (SAP). METHODS: Observational cross-sectional study. Sixty two glaucoma patients and 48 healthy individuals were included. All patients underwent a complete ophthalmologic examination, achromatic standard automated perimetry (SAP) and retinal nerve fiber layer (RNFL) imaging with SD-OCT (Cirrus HD-OCT; Carl Zeiss Meditec Inc., Dublin, California). Receiver operating characteristic (ROC) curves were obtained for all SD-OCT parameters and global indices of SAP. Subsequently, the following MLCs were tested using parameters from the SD-OCT and SAP: Bagging (BAG), Naive-Bayes (NB), Multilayer Perceptron (MLP), Radial Basis Function (RBF), Random Forest (RAN), Ensemble Selection (ENS), Classification Tree (CTREE), Ada Boost M1(ADA),Support Vector Machine Linear (SVML) and Support Vector Machine Gaussian (SVMG). Areas under the receiver operating characteristic curves (aROC) obtained for isolated SAP and OCT parameters were compared with MLCs using OCT+SAP data. RESULTS: Combining OCT and SAP data, MLCs' aROCs varied from 0.777(CTREE) to 0.946 (RAN).The best OCT+SAP aROC obtained with RAN (0.946) was significantly larger the best single OCT parameter (p<0.05), but was not significantly different from the aROC obtained with the best single SAP parameter (p=0.19). CONCLUSION: Machine learning classifiers trained on OCT and SAP data can successfully discriminate between healthy and glaucomatous eyes. The combination of OCT and SAP measurements improved the diagnostic accuracy compared with OCT data alone.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Dental impression is an important step in the preparation of prostheses since it provides the reproduction of anatomic and surface details of teeth and adjacent structures. The objective of this study was to evaluate the linear dimensional alterations in gypsum dies obtained with different elastomeric materials, using a resin coping impression technique with individual shells. A master cast made of stainless steel with fixed prosthesis characteristics with two prepared abutment teeth was used to obtain the impressions. References points (A, B, C, D, E and F) were recorded on the occlusal and buccal surfaces of abutments to register the distances. The impressions were obtained using the following materials: polyether, mercaptan-polysulfide, addition silicone, and condensation silicone. The transfer impressions were made with custom trays and an irreversible hydrocolloid material and were poured with type IV gypsum. The distances between identified points in gypsum dies were measured using an optical microscope and the results were statistically analyzed by ANOVA (p < 0.05) and Tukey's test. The mean of the distances were registered as follows: addition silicone (AB = 13.6 µm, CD=15.0 µm, EF = 14.6 µm, GH=15.2 µm), mercaptan-polysulfide (AB = 36.0 µm, CD = 36.0 µm, EF = 39.6 µm, GH = 40.6 µm), polyether (AB = 35.2 µm, CD = 35.6 µm, EF = 39.4 µm, GH = 41.4 µm) and condensation silicone (AB = 69.2 µm, CD = 71.0 µm, EF = 80.6 µm, GH = 81.2 µm). All of the measurements found in gypsum dies were compared to those of a master cast. The results demonstrated that the addition silicone provides the best stability of the compounds tested, followed by polyether, polysulfide and condensation silicone. No statistical differences were obtained between polyether and mercaptan-polysulfide materials.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The prosthetic rehabilitation of an atrophic mandible is usually unsatisfactory due to the lack of support tissues, mainly bone and keratinized mucosa for treatment with osseointegrated implants or even conventional prosthesis. The prosthetic instability leads to social and functional limitations and chronic physical trauma decreasing the patient's quality of life. A 53-year-old female patient sought care at our surgical service complaining of impairment of her masticatory function associated with the instability of the lower total prosthetic denture. The clinical and complementary exams revealed edentulism in both arches, while the mandibular arch presented severe reabsorption resulting in denture instability and chronic trauma to the oral mucosa. The proposed treatment plan consisted in the mandibular rehabilitation with osseointegrated implants and fixed Brånemark's protocol prosthesis after mandibular reconstruction applying the modified visor osteotomy technique. The proposed technique offered predictable results for reconstruction of the severely resorbed edentulous mandible and posterior rehabilitation with osseointegrated implants.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The aim of this study was to evaluate the microbial distribution in the root canal system after periapical lesion induction in dogs' teeth using different methods. Fifty-two root canals were assigned to 4 groups (n=13). Groups I and II: root canals were exposed to the oral cavity for 180 days; groups III and IV: root canals were exposed for 7 days and then the coronal openings were sealed for 53 days. The root apices of groups I and III were perforated, while those of groups II and IV remained intact. After the experimental periods, the animals were euthanized and the anatomic pieces containing the roots were processed and stained with the Brown & Brenn method to assess the presence and distribution of microorganisms. The incidence of microorganisms at different sites of the roots and periapical lesions was analyzed statistically by the chi-square test at 5% significance level. All groups presented microorganisms in the entire root canal system. A larger number of microorganisms was observed on the root canal walls, apical delta and dentinal tubules (p<0.05), followed by cementum and cemental resorption areas. In spite of the different periods of exposure to the oral environment, the methods used for induction of periapical periodontitis yielded similar distribution of microorganisms in the root canal system.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

This study ascertained whether under dental erosion models that closely mimics the real-life situation enamel and root dentin from bovine origin would be reliable substitutes for human counterparts. Through a 2x2 crossover design, in a first trial, 14 volunteers wore a palatal device containing slabs of bovine and human enamel. Half of the participants ingested (4x daily, for 10 days) orange juice first, crossing over to mineral water, while the remainder received the reverse sequence. In a second trial, volunteers wore devices with slabs of bovine and human root dentin. Except for the duration of each intraoral phase, which lasted 2 rather 10 days, the experiment with root dentin run exactly as for enamel. Dental substrates were analyzed for surface microhardness. Two-way ANOVAs (α=0.05) indicated no difference between the microhardness values recorded for human and bovine enamel (p=0.1350), but bovine root dentin had lower microhardness compared to its human counterpart (p=0.0432). While bovine enamel can reliably substitute its human counterpart in in situ dental erosion models, bovine root dentin does not seem to be a viable alternative to the corresponding human tissue.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

This article describes and discusses a method to determine root curvature radius by using cone-beam computed tomography (CBCT). The severity of root canal curvature is essential to select instrument and instrumentation technique. The diagnosis and planning of root canal treatment have traditionally been made based on periapical radiography. However, the higher accuracy of CBCT images to identify anatomic and pathologic alterations compared to panoramic and periapical radiographs has been shown to reduce the incidence of false-negative results. In high-resolution images, the measurement of root curvature radius can be obtained by circumcenter. Based on 3 mathematical points determined with the working tools of Planimp® software, it is possible to calculate root curvature radius in both apical and coronal directions. The CBCT-aided method for determination of root curvature radius presented in this article is easy to perform, reproducible and allows a more reliable and predictable endodontic planning, which reflects directly on a more efficacious preparation of curved root canals.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

PURPOSE: Maxillary sinus lifting is a technique, in which, a possible complication is sinus membrane perforation. The aim of this study was to compare two techniques using ultrasound surgery to perform autogenous graft for maxillary sinus lifting. METHODS: Ten rabbits were used in the study, one of them did not undergo surgery. The other nine rabbits had their maxillary sinuses filled with autogenous bone grafts collected from the external skull diploe in particulate form on the right side, and shaved on the left side, both with ultrasonic device. Data on bone density in left and right maxillary sinus, obtained by computed tomography in transverse and longitudinal sections, recorded 90 days after the grafts, were statistically compared. RESULTS: There were no statistically significant differences between the two techniques that used shaved and particulate bone collected by means of ultrasonic device from rabbit skulls. CONCLUSION: Assessment of operative procedures led to the conclusion that piezoelectric ultrasound was shown to be a safe tool in the surgical approach to the maxillary sinus of rabbits, allowing sinus membrane integrity to be maintained during surgical procedures.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

This in vivo study evaluated the dissociation quality of maxillary premolar roots combining variations of vertical and horizontal angulations by using X-ray holders (Rinn -XCP), and made a comparison between two types of intraoral radiography systems - conventional film (Kodak Insight, Rochester, USA) and digital radiography (Kodak RVG 6100, Kodak, Rochester, USA). The study sample was comprised of 20 patients with a total of 20 maxillary premolars that were radiographed, using the paralleling angle technique (GP), with a 20º variation of the horizontal angle (GM) and 25º variation of the horizontal angle combined with 15º vertical angle (GMV). Each image was independently analyzed by two experienced examiners. These examiners assigned a score to the diagnostic capability of root dissociation and the measurement of the distance between the apexes. Statistical data was derived using the Wilcoxon Signed Rank test, Friedman and T test. The means of the measured distances between buccal and lingual root apexes were greater for the GMV, which ranged from 2.3 mm to 3.3 mm. A statistically significant difference was found between GM and GMV when compared to GP with p < 0.01. An established best diagnostic dissociation roots image was found in the GMV. These results support the use of the anterior X-ray holders which offer a better combined deviation (GMV) to dissociate maxillary premolar roots in both radiography systems.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The aim of this study was to assess qualitatively, by means of SEM images, the cleaning of the dentin walls of root canals after chemical-surgical preparation using Endo-PTC cream with 0.5% and 1% sodium hypochlorite and different final irrigating solutions. Seventy-two single-rooted human teeth were divided into eight groups and prepared using Endo-PTC cream with sodium hypochlorite (NaOCl) at different concentrations, and irrigated with NaOCl at different concentrations. Final irrigation was performed with either EDTA-T or EDTA-C. The best results were obtained with Group 1, followed by Groups 5, 2, 7, 8, 3, 6 and 4. We can conclude that the use of 0.5% NaOCl during instrumentation and final flush of the root canals was more efficient in cleaning than was 1% sodium hypochlorite. EDTA-T was more efficient in removing smear layer than EDTA-C, and the cervical third presented better cleaning of the root canal walls than did the middle third, which showed cleaner dentin walls than the apical third.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Conventional radiography has shown limitation in acquiring image of the ATM region, thus, computed tomography (CT) scanning has been the best option to the present date for diagnosis, surgical planning and treatment of bone lesions, owing to its specific properties. OBJECTIVE: The aim of the study was to evaluate images of simulated bone lesions at the head of the mandible by multislice CT. MATERIAL AND METHODS: Spherical lesions were made with dental spherical drills (sizes 1, 3, and 6) and were evaluated by using multislice CT (64 rows), by two observers in two different occasions, deploying two protocols: axial, coronal, and sagittal images, and parasagittal images for pole visualization (anterior, lateral, posterior, medial and superior). Acquired images were then compared with those lesions in the dry mandible (gold standard) to evaluate the specificity and sensibility of both protocols. Statistical methods included: Kappa statistics, validity test and chi-square test. Results demonstrated the advantage of associating axial, coronal, and sagittal slices with parasagittal slices for lesion detection at the head of the mandible. RESULTS: There was no statistically significant difference between the types of protocols regarding a particular localization of lesions at the poles. CONCLUSIONS: Protocols for the assessment of the head of the mandible were established to improve the visualization of alterations of each of the poles of the mandible's head. The anterior and posterior poles were better visualized in lateral-medial planes while lateral, medial and superior poles were better visualized in the anterior-posterior plane.