999 resultados para Microscopia - Força atômica


Relevância:

20.00% 20.00%

Publicador:

Resumo:

This work reports the influence of the poly (ethylene terephthalate) textile and films surface modification by plasmas of O2 and mixtures (N2 + O2), on their physical and chemical properties. The plasma surface polymeric modification has been used for many researchs, because it does not affect the environment with toxic agents, the alterations remains only at nanometric layers and this technique shows expressive results. Then, due to its good acceptance, the treatment was carried out in a vacuum chamber. Some parameters remained constant during all treatment, such as: Voltage 470 V; Pressure 1,250 Mbar; Current: 0, 10 A and gas flow: 10 cm3/min, using oxygen plasma alternating the treatment time 10 to 60 min with an increase of 10 min to each subsequent treatment. Also, the samples were treated with a gas mixture (nitrogen + oxygen) which was varied only the gas composition from 0 to 100% leaving the treatment time remaining constant to all treatment (10 min). The plasma treatment was characterized in-situ with Optics Emission Spectroscopy (OES), and the samples was characterized by contact angle, surface tension, Through Capillary tests, Raman spectroscopy, Infrared attenuated total reflection (IR-ATR) and atomic force microscopy, scanning electronic Microscopy (SEM) and X-ray Photoelectron Spectroscopy (XPS). The results showed that oxygen treated fabrics presented high wettability, due to the hydrophilic groups incorporation onto the surface formed through spputering of carbon atoms. For the nitrogen atmosphere, there is the a film deposition of amine groups. Treatment with small oxygen concentration in the mixture with nitrogen has a higher spputered species of the samples

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The technique of plasma nitriding by the cathode cage mainly stands out for its ability to produce uniform layers, even on parts with complex geometries. In this study, it was investigated the efficiency of this technique for obtaining duplex surface, when used, simultaneously, to nitriding treatment and thin film deposition at temperatures below 500°C. For this, were used samples of AISI 41 0 Martensitic Stainless Steel and performed plasma treatment, combining nitriding and deposition of thin films of Ti and/or TiN in a plasma atmosphere containing N2-H2. It was used a cathodic cage of titanium pure grade II, cylindrical with 70 mm diameter and 34 mm height. Samples were treated at temperature 420ºC for 2 and 12 hours in different working pressures. Optical Microscopy (OM), Scanning Electron Microscopy (SEM) with micro-analysis by Energy Dispersive Spectroscopy (EDS), X-Ray Diffraction (XRD), Atomic Force Microscopy (AFM) and analysis of Vickers Microhardness were used to investigate coating properties such as homogeneity and surface topography, chemical composition, layer thickness, crystalline phase, roughness and surface microhardness. The results showed there is a direct proportionality between the presence of H2 in plasma atmosphere and the quantity of titanium in surface chemical composition. It was also observed that the plasma treatment at lowpressure is more effective in formation of TiN thin film

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A polyester film has a vast application field, due some properties that are inherent of this kind of material such as, good mechanical resistance, chemical resistance to acids and bases and low production cost. However, this material has some limitations as low superficial tension, flat surface, low affinity to dyers, and poor adhesion which impede the use of the same ones for some finality as good wettability. Among the existent techniques to increase the superficial tension, plasma as energy source is the more promising technique, because of their versatility and for not polluting the environment. The plasma surface polymeric modification has been used for many researchers, because it does not affect the environment with toxic agents, the alterations remains only at nanometric layers and this technique shows expressive results. Then, due to its good acceptance, polyester films were treated with oxygen plasma varying the treatment time from 10 to 60 min with an increase of 10 min to each subsequent treatment. Also, the samples were treated with a gas mixture (nitrogen + oxygen) varying the percentage of each gas the mixture from 0 to 100%, the treatment time remaining constant to all treatments (10 min). After plasma treatment the samples were characterized by contact angle, surface tension, Raman spectroscopy, Infrared attenuated total reflection (IR-ATR) and atomic force microscopy, with the aim to study the wettability increase of treated polyester films as its variables. In the (O2/N2) plasma treatment of polyester films can be observed an increase of superficial roughness superior to those treated by O2 plasma. By the other hand, the chemical modification through the implantation of polar groups at the surface is obtained more easily using O2 plasma treatment

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Chitosan is being studied for use as dressing due their biological properties. Aiming to expand the use in biomedical applications, chitosan membranes were modified by plasma using the following gases: nitrogen (N2), methane (CH4), argon (Ar), oxygen (O2) and hydrogen (H2). The samples were characterized by scanning electron microscopy (SEM), atomic force microscopy (AFM), contact angle, surface energy and water absorption test. Biological Tests were also performed, such as: test sterilization and proliferation of fibroblasts (3T3 line). Through SEM we observed morphological changes occurring during the plasma treatment, the formation of micro and nano-sized valleys. MFA was used to analyze different roughness parameters (Ra, Rp, Rz) and surface topography. It was found that the treated samples had an increase in surface roughness and sharp peaks. Methane plasma treatment decreased the hydrophilicity of the membranes and also the rate of water absorption, while the other treatments turned the membranes hydrophilic. The sterilization was effective in all treatment times with the following gases: Ar, N2 and H2. With respect to proliferation, all treatments showed an improvement in cell proliferation increased in a range 150% to 250% compared to untreated membrane. The highlights were the treatments with Ar 60 min, O2 60 min, CH4 15 min. Observing the results of the analyzes performed in this study, it appears that there is no single parameter that influences cell proliferation, but rather a set of ideal conditions that favor cell proliferation

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Más de 12000 m3 de mucilago de cacao CCN-51 son producidos y abandonados en las fincas de cacao en el Ecuador cada año. El estudio tiene como objetivo caracterizar este residuo en la Zona 6. Las muestras se obtuvieron de 10 lugares dentro de la zona de estudio, las mismas que están geo referenciadas. Para el análisis se usó espectrofotometría UV-Visible para la identificación de azucares reductoras totales, y espectrofotometría de absorción atómica para identificar minerales. Además se determinó parámetros físicos. Los resultados de los análisis fueron los siguientes: pH 4.05±0.004, los sólidos solubles fue de 17.15±0.86 0Brix, la acidez Titulable fue 245.25±21.19 meq/L. Por otra parte las azucares reductoras totales fueron de 1228.82±178.52 g/L y los de calcio, sodio y potasio fueron de 169.21±31.04 mg/L, 161.85±40.41 mg/L, 462.9±49.96 mg/L respectivamente. Se analizó una muestra mediante espectroscopia de infrarrojo para identificar glucosa y sacarosa, los resultados de este análisis fueron 398 g/L, 800g/l, posteriormente se realizó un análisis t student con el resultado obtenido en espectrofotometría UV-Visible de las azucares reductoras totales, como resultado final se estableció que no existe diferencia significativa entre las dos técnicas instrumentales.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

La presente investigación tuvo como finalidad analizar esta especie vegetal cultivada en la zona Central y Occidental del territorio salvadoreño; para ello, se llevó a cabo una investigación de campo visitando los Municipios de Colón y Ciudad Arce ubicados en el Departamento de la Libertad; y los Municipios de Izalco y Nahuizalco, ambos pertenecientes al Departamento de Sonsonate; donde se recolectaron las muestras (hojas de C. longirostrata); Se elaboraron encuestas dirigidas a Técnicos ó Ingenieros agrónomos que laboraran en Agroservicios de mayor afluencia en el país y a los productores de los cultivos seleccionados; con la finalidad de conocer los productos agroquímicos aplicados al tratamiento del cultivo de esta hortaliza. Se realizó un análisis químico e instrumental para determinar elementos metálicos como metales pesados (plomo y arsénico) y oligoelementos (hierro, cobre y zinc) utilizando las técnicas de Espectrofotometría de Absorción Atómica (EAA): - Horno de grafíto para plomo. - Generador de Hidruros para arsénico. - Llama para hierro, cobre y zinc. Los resultados se compararon con los límites máximos establecidos por la normativa de JECFA - Comité Mixto FAO/OMS de Expertos en Aditivos Alimentarios y Codex Alimentarius; y se evaluaron estadísticamente a través del análisis de varianza de un factor (ANOVA), las pruebas de comparación DMS y Bonferroni; para evaluar el comportamiento de los datos experimentales obtenidos en el análisis. Según los resultados obtenidos se encontraron trazas de plomo y arsénico en algunas muestras analizadas; así como un alto contenido de hierro, cobre y zinc en todas las muestras de C. longirostrata. Se recomienda que se analicen muestras de suelos, agua de riego y otros cultivos de C. longirostrata ubicados en diversas zonas geográficas de El Salvador; con la finalidad de evaluar la calidad de las distintas hortalizas de esta especie vegetal existentes en el país.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

El presente trabajo de Grado tiene como propósito examinar la incidencia de las sancionesinternacionales en el marco del régimen de no proliferación nuclear en el caso de Irán durante el periodo 2006-2015, teniendo en cuenta factores históricos de años anteriores. Se analiza y explica cómo las sanciones internacionales pueden ser una medida persuasiva por violar ciertos artículos del Tratado de no Proliferación Nuclear. Finalmente identifica y analiza los tipos de sanciones económicas, financieras y comerciales que los Estados y el Consejo de Seguridad de las Naciones Unidas le han impuesto a Irán, así como la manera en que estas han incidido en la esfera política iraní y mundial.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The durability of the cellulose-cement composites is a decisive factor to introduce such material in the market. Polymers have been used in concrete and mortar production to increase its durability. The goal of this work was the physical and mechanical characterization of cellulose-cement composites modified by a polymer and the subsequent durability evaluation. The work also evaluated the dispersion of acrylic polymer in composites made of Pinus caribaea residues. The physical properties observed were water absorption by immersion and bulk density. Rupture modulus and toughness were determined by flexural test. The specimens were obtained from pads, produced by pressing and wet curing. Samples were subjected to accelerated aging tests by repeated wetting and drying cycles and hot-water bath and natural aging. The scanning electron microscopy (SEM) allowed verifying the fiber and composite characteristics along the time. For the composite range analyzed, it was observed the polymer improved the mechanical properties of composites besides a significant decreasing in water absorption. The use of polymer improved the performance of vegetable fiber-cement composites when compared to the conventional mortar, due to water absorption decreasing.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Dahlstedtia Malme (Leguminosae) is a neotropical genus, native to the Brazilian Atlantic Forest, and comprises two species, D. pinnata (Benth.) Malme and D. pentaphylla (Taub.) Burk., although it has been considered a monotypic genus by some authors. Leaf anatomy was compared to verify the presence of anatomical characters to help delimit species. Foliar primordium, leaflet, petiolule, petiole and pulvinus were collected from cultivated plants (Campinas, SP, Brazil) and from natural populations (Picinguaba, Ubatuba and Caraguatatuba, SP, Brazil - D. pinnata; Antonina, PR, Brazil - D. pentaphylla). Studies on leaflet surface assessment (Scanning Electron Microscopy), as well as histology and venation analyses were carried out of dehydrated, fresh and fixed material from two species. Leaflet material was macerated for stomatal counts. Histological sections, obtained by free-hand cut or microtome, were stained with Toluidine Blue, Safranin/Alcian Blue, Ferric Chloride, Acid Phloroglucin. Secretory cavities are present in the lamina, petiolule, petiole, pulvinus and leaf primordium in D. pentaphylla, but not in D. pinnata, and can be considered an important character for species diagnosis. Other leaf characters were uninformative in delimiting Dahlstedtia species. There is cambial activity in the petiolule, petiole and pulvinus. This study, associated with other available data, supports the recognition of two species in Dahlstedtia.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Cuphea carthagenensis (Jacq.) J.F. Macbr. is an herb, which occurs preferably in wet places. Amongst other species of the genus, C. carthagenensis is distinguished for its great chemical potential and frequent use in popular medicine. In this study the morphological and anatomical structures were identified, as well as the histochemical characterization was done. Samples of root, stem and leaves were collected from adult plants. This material was processed for anatomical and histochemical analysis in light microscopy and for morphological analysis, in scanning electron microscopy. Important morphological and anatomical considerations were added for C. carthagenensis, such as: the occurrence of aerenchymatous phellem with suberized layers; the types of trichomes present in the vegetative organs, the characterization of secretory trichomes, as well as the secreted substances. The groups of secondary metabolites presents in the root, stem and leaf of C. carthagenensis with more intense histochemical reaction were: proanthocyanidins, phenolic compounds, acids polysaccharides (mucilage especially) and lipids.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The present work evaluated the effect of low doses of X-irradiation on the repairing process of sutured and nonsutured skin wounds in rats. For that, rats underwent a surgical proceedure, in which a 20 x 5-millimeter rectangular wound approximately 2-millimeter-deep was made in the dorsal region of each animal, and were divided in four groups: nonirradiated nonsutured; irradiated nonsutured ; nonirradiated sutured and irradiated sutured. The animals under irradiation were protected, during exposure, with a 2-millimeter-thick lead apron in such a way that only the incision was irradiated. Each animal was submitted to 18 seconds of exposure, undergoing a total of 7.4 rads. The evaluation of the effects of X-rays on the repairing process was carried out through microscopic observation by means of hematoxylin-eosin staining for morphological evaluation, and silver impregnation under polarized light for the observation of collagen synthesis. The results have shown that X-irradiation has caused delay in the repairing process, but it did not stop its development. The irradiated nonsutured group was considered to show the greater delay when compared with the other groups.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

It was done microencapsulation of natural essencial orange oil through spray-drying. The purpose was to use the best proportion of wall materials among maltodextrin, acacia gum, and modified starch (capsul) in order to retain greater amount of orange oil. The orange oil (10%) and maltodextrin (36%) remained constant. Three spray drying temperatures were employed: 180°C, 200°C and 220°C, therefore, nine final products were obtained. The superficial and inner oil concentrations were measured. The microcapsules were also examined through optical and scanning electron microscopy. The three temperatures employed did not affect the microencapsulation. The microstructure of the capsules were almost similar regardless the proportion employed among the carbohydrates to wall composition. At light microscopy it was observed a great heterogeneity of capsules diameters, and probably not smooth surfaces; at scanning electron microscopy it was clear that the walls displayed porosity over round surfaces. The best retention was given by the formula containing 10% of capsul, 10% of orange oil and 36% of maltodextrin, when total oil retention was 94%, regardless the drying temperature here employed.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Neuronal ceroid-lipofuscinosis (NCL) is a recent term, proposed for acurate designation of the late-onset types of Amaurotic Family Idiocy (AFI). Histopathology shows ubiquitous intraneuronal accumulation of lipopigments, being the most important factor for characterization of the entity at present time. Biochemical changes and pathogenesis are obscure. NCL is in contrast to the infantile type of AFI (Tay-Sachs disease), in which intraneuronal accumulation of gangliosides (sphingolipids) is due to the well known deficiency of a lysosomal enzyme. The authors report on four cases of NCL, two brothers of the late infantile (Jansky-Bielschowsky) type and a brother and a sister of the juvenile (Spielmeyer-Sjögren) type. One autopsy and three cortical biopsies revealed moderate to severe distention of the neurons by lipopigment, with nerve cell loss, gliosis and cerebral atrophy. Lipopigment was also increased in liver, heart and spleen. The patients were the first in Brazilian literature in whom the storage material was identified as lipopigment by histochemical methods. A brief summary of the clinical features of NCL is presented, and relevant problems are discussed, concerning interpretation of the nature of the storage material, and significance of the disease for gerontological research.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Removable partial dentures (RPD) demand specific hygienic cleaning and the combination of brushing with immersion in chemical solutions has been the most recommended method for control of biofilm. However, the effect of the cleansers on metallic components has not been widely investigated. This study evaluated the effect of different cleansers on the surface of RPD. Five disc specimens (12 mm x 3 mm metallic disc centered in a 38 x 18 x 4 mm mould filled with resin) were obtained for each experimental situation: 6 solutions [Periogard (PE), Cepacol (CE), Corega Tabs (CT), Medical Interporous (MI), Polident (PO), 0.05% sodium hypochlorite (NaOCl), and distilled water (DW) control] and 2 Co-Cr alloys [DeguDent (DD) and VeraPDI (VPDI)] were used for each experimental situation. A 180-day immersion was simulated and the measurements of roughness (Ra, µm) of metal and resin were analyzed using 2-way ANOVA and Tukey’s test. The surface changes and tarnishes were examined with a scanning electronic microscopy (SEM). In addition, energy dispersive x-ray spectrometry (EDS) analysis was carried out at representative areas. Visually, NaOCl and MI specimens presented surface tarnishes. The roughness of materials was not affected by the solutions (p>0.05). SEM images showed that NaOCl and MI provided surface changes. EDS analysis revealed the presence of oxygen for specimens in contact with both MI and NaOCl solutions, which might suggest that the two solutions promoted the oxidation of the surfaces, thus leading to spot corrosion. Within the limitations of this study, it may be concluded that the NaOCl and MI may not be suitable for cleaning of RPD.