Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Comparação da eficácia da ropivacaína 1% quando associada ou não à hialuronidase na anestesia peribulbar para cirurgia de catarata

Purpose: To evaluate the onset time and quality of peribulbar anesthesia with 1% ropivacaine associated or not with hyaluronidase 100 tru/ml for cataract extraction. Methods: Prospective, randomized, double-blind and controlled study including fifty-seven patients, scheduled to undergo peribulbar anesthesia for cataract extraction, allocated to two groups. Group C: 1% ropivacaine with addition of 100 tru/ml hyaluronidase, and Group S 1% ropivacaine, without hyaluronidase. The onset time for globe akinesia was studied at intervals of 2 minutes, using Nicoll's score. We evaluated pain by analogic score during the surgery and the necessity of complementing the anaesthesia. The peribulbar block was considered satisfactory when the Nicoll's score was less than 4. Results: The mean time of onset of block in group C was 4.07 minutes (± 3.24), and in group S 5.03 (± 3.28). There was no statistically significant difference between the groups. Both were similar regarding pain score, no pain was observed in 57.14% of group C, and in 68.97% of group S. The supplementary anesthetic was necessary in 2 cases of group C and in 3 cases of group S. Two cases of bradycardia (heart rate < 50 bpm) were observed during the surgery, and in one case administration of atropine IV was necessary. Conclusion: 1% ropivacaine provided a good quality of anesthesia for cataract extraction, with a faster onset of action in the group with hyaluronidase 100 iu/ml, although without significant difference.

Eficácia na utilização de córneas no transplante penetrante

PURPOSES: 1) To verify the impact of the creation of the Single Technical Record (STR) at the University of Campinas (Unicamp) Hospital das Clínicas, on the preservation period of corneas which were used in elective penetrating keratoplasties, and 2) to compare the primary failure incidence in cornea penetrating keratoplasties regarding the periods before and after the creation of STR. METHODS: A retrospective study was conducted at the Unicamp Hospital, which evaluated 15 consecutive cornea penetrating keratoplasties between January 1st and April 30th, 2000 and 24 consecutive penetrating keratoplasties between May 1st and September 20th of the same year (corneas under the control of the STR), totaling 39 keratoplasties. RESULTS: The mean time between cornea preparation and transplantation was 3.8 days (±1.78) in the period before STR creation, and 6.0 days (±2.97) after STR creation, representing a 36.7% increase in the preservation time. There was a statistically significant difference (p=0.02) between the two groups. No corneal primary failure was observed among the 39 transplanted patients in both groups. CONCLUSION: Based on the results of this study, it can be concluded that this new concept of the State Transplantation System has caused a statistically significant increase in the conservation period of corneas, which may reduce the period of a clear transplant due to an increased loss of endothelial cells, as well as increase the primary failure incidence or result in a high number of corneas that cannot be used due to having exceeded the preservation time recommended by the literature.

Óculos de baixo custo: experiência em Divinolândia (SP)

INTRODUCTION: In Divinolândia (SP), the Consortium of Development of São João da Boa Vista Region Policy (CONDERG), in partnership with State University of Campinas (UNICAMP), has founded an eyeglass store to produce low cost glasses to distribute freely to their customers. The purpose is to analyze the evolution and working process of CONDERG eyeglass store in the last 13 years, since its foundation. METHODS: Data were collected from CONDERG store files from 1988 to 2001. Data regarding the amount of spectacles produced per year, ability to increase the production and store feasibility were analyzed. RESULTS: In 13 years, 16,500 spectacles were supplied. Currently, 400 spectacles are delivered per month, being 200 supported by SUS and the other 200 by CONDERG's own resources. CONCLUSION: The 13-year operation of CONDERG eyeglass store, the free provision of 16,500 spectacles and the increase productive ability have shown this model feasibility.

Crescimento, composição corporal e performance motora em crianças e adolescentes de 7 a 14 anos provenientes de familias de baixo nivel socio-economico e participantes do projeto esporte solidario, São Luis - MA

Universidade Estadual de Campinas . Faculdade de Educação Física

O corpo e o sagrado : o renascimento do sagrado atraves do discurso da corporeidade

Universidade Estadual de Campinas . Faculdade de Educação Física

Indicadores de saude em mulheres acima de 50 anos de idade participantes de um programa de atividades fisicas no complexo da Mare-RJ

Univesidade Estadual de Campinas. Faculdade de Educação Física

Mudanças nas variaveis de aptidão fisica numa equipe de futebol da 1ª divisão do campeonato nacional durante uma pre-temporada

Universidade Estadual de Campinas . Faculdade de Educação Física

A influência do protocolo de extração de dois pré-molares superiores na estabilidade oclusal do tratamento da Classe II

OBJETIVO: com o propósito de avaliar a influência da extração de dois pré-molares superiores na estabilidade oclusal do tratamento da má oclusão de Classe II completa, foi realizada uma comparação com o protocolo de tratamento sem extrações. MÉTODOS: selecionou-se, a partir das documentações do arquivo da Disciplina de Ortodontia da Faculdade de Odontologia de Bauru, uma amostra composta pelas documentações de 59 pacientes com má oclusão de Classe II completa. Em seguida, dividiu-se essa amostra em dois grupos, apresentando as seguintes características: Grupo 1, constituído por 29 pacientes, tratados sem extrações; e Grupo 2, composto por 30 pacientes, tratados com extrações de dois pré-molares superiores. Os modelos ao início do tratamento, ao final do tratamento e em um período mínimo de 2,4 anos após o tratamento foram medidos e avaliados por meio dos índices oclusais IPT e PAR. As condições oclusais ao final do tratamento e no estágio pós-tratamento, o percentual de recidiva e as alterações oclusais pós-tratamento foram comparados por meio do teste t. RESULTADOS: os resultados demonstraram que os protocolos de tratamento sem extração e com extrações de dois pré-molares superiores não apresentaram, em nenhuma das variáveis avaliadas, diferenças estatisticamente significativas em relação à estabilidade oclusal do tratamento da má oclusão de Classe II completa. CONCLUSÃO: a extração de dois pré-molares superiores no tratamento da má oclusão de Classe II completa não influenciou a estabilidade dos resultados oclusais alcançados ao final da correção ortodôntica. Portanto, terminar o tratamento com uma relação molar em Classe II ou em Classe I proporciona estabilidade semelhante.

Short-Term effect of COX-2 selective inhibitor as an adjunct for the treatment of periodontal disease: a clinical double-blind study in humans

Adjunctive therapeutic strategies that modulate the inflammatory mediators can play a significant role in periodontal therapy. In this double-blind, placebo-controlled study, 60 subjects diagnosed as periodontitis patients were evaluated for 28 days after periodontal treatment combined with selective cyclooxygenase-2 (COX-2) inhibitor. The experimental group received scaling and root planning (SRP) combined with the Loxoprofen antiinflammatory drug (SRP+Loxoprofen). The control group received SRP combined with placebo (SRP+placebo). Plaque index (PI), probing pocket depth (PD) and bleeding on probing (BOP) were monitored with an electronic probe at baseline and after 14 and 28 days. Both groups displayed clinical improvement in PD, PI and BOP. They also showed statistically similar values (p>0.05) of PD reduction on day 14 (0.4 mm) and on day 28 (0.6 mm). At the baseline, few deeper sites (>7 mm) from SRP+Loxoprofen group were responsible and most PD reduction was observed after 14 days (p<0.05). The percentage of remaining deep pockets (>7 mm) after 14 days in the SRP+Loxoprofen group was significantly lower (p<0.05) than in the SRP+placebo group. Loxoprofen presents potential effect as an adjunct of periodontal disease treatment, but long-term clinical trials are necessary to confirm its efficacy.

Large apical periodontitis healing following root canal dressing with calcium hydroxide: a case report

PURPOSE: The objective of this paper is to report the clinical case of a patient who presented a chronic apical periodontitis, arising from internal inflammatory resorption followed by pulp necrosis, and a long-term success of a root canal therapy using calcium hydroxide as root canal dressing. CASE DESCRIPTION: A 20-year-old male patient presented for routine dental treatment. By radiographic examination we noted an extensive radioluscent area, laterally to the permanent maxillary right lateral incisor, with possibility of communication with the lateral periodontium, suggestive of a chronic apical periodontitis. Due to external root resorption detection, we used a calcium hydroxide root canal dressing, changed every 15 days, for a period of 2 months. Root canal filling was performed using gutta-percha cones by lateral condensation technique Radiographic follow up held after 19 years of treatment indicated a periodontium in conditions of normality, with the presence of lamina dura. CONCLUSION: Calcium hydroxide is a suitable material to be used as root canal dressing in teeth with apical periodontitis. Long-term evaluation demonstrated the satisfactory clinical outcome following root canal treatment.

Subcutaneous connective tissue response to primary root canal filling materials

This study evaluated the response of the subcutaneous connective tissue of BALB/c mice to root filling materials indicated for primary teeth: zinc oxide/eugenol cement (ZOE), Calen paste thickened with zinc oxide (Calen/ZO) and Sealapex sealer. The mice (n=102) received polyethylene tube implants with the materials, thereby forming 11 groups, as follows: I, II, III: Calen/ZO for 7, 21 and 63 days, respectively; IV, V, VI: Sealapex for 7, 21 and 63 days, respectively; VII, VIII, IX: ZOE for 7, 21 and 63 days, respectively; X and XI: empty tube for 7 and 21 days, respectively. The biopsied tissues were submitted to histological analysis (descriptive analysis and semi-quantitative analysis using a scoring system for collagen fiber formation, tissue thickness and inflammatory infiltrate). A quantitative analysis was performed by measuring the area and thickness of the granulomatous reactionary tissue (GRT). Data were analyzed by Kruskal-Wallis, ANOVA and Tukey's post-hoc tests (?=0.05). There was no significant difference (p>0.05) among the materials with respect to collagen fiber formation or GRT thickness. However, Calen/ZO produced the least severe inflammatory infiltrate (p<0.05). The area of the GRT was significantly smaller (p<0.05) for Calen/ZO and Sealapex. In conclusion, Calen/ZO presented the best tissue reaction, followed by Sealapex and ZOE.

Congenital eruption cyst: a case report

Congenital pathologies are those existing at or dating from birth. Occurrence of congenital cystic lesions in the oral cavity is uncommon in neonates. Eruption cyst (EC) is listed among these unusual lesions. It occurs within the mucosa overlying teeth that are about to erupt and, according to the current World Health Organization (WHO) classification of epithelial cysts of the jaws, EC is a separate entity. This paper presents a case of congenital EC successfully managed by close monitoring of the lesion, without any surgical procedure or tooth extraction. Eruption of the teeth involved, primary central incisors, occurred at the fourth month of age. During this time neither the child nor mother had any complication such as pain on sucking, refusal to feed, airway obstruction, or aspiration of fluids or teeth.

Histopathological evaluation of root canal filling materials for primary teeth

This study aimed to assess the response of apical and periapical tissues of dogs' teeth after root canal filling with different materials. Forty roots from dogs' premolars were prepared biomechanically and assigned to 4 groups filled with: Group I: commercial calcium hydroxide and polyethylene glycol-based paste (Calen®) thickened with zinc oxide; Group II: paste composed of iodoform, Rifocort® and camphorated paramonochlorophenol; Group III: zinc oxide-eugenol cement; Group IV: sterile saline. After 30 days, the samples were subjected to histological processing. The histopathological findings revealed that in Groups I and IV the apical and periapical regions exhibited normal appearance, with large number of fibers and cells and no resorption of mineralized tissues. In Group II, mild inflammatory infiltrate and mild edema were observed, with discrete fibrogenesis and bone resorption. Group III showed altered periapical region and thickened periodontal ligament with presence of inflammatory cells and edema. It may be concluded that the Calen paste thickened with zinc oxide yielded the best tissue response, being the most indicated material for root canal filling of primary teeth with pulp vitality.

Periapical repair after root canal filling with different root canal sealers

The aim of this study was to evaluate periapical repair after root canal filling with different endodontic sealers. Sixty-four root canals from dog´s teeth were filled, divided into 4 groups (n=16). Root canals were instrumented with K-type files and irrigated with 1% sodium hypochlorite solution. Root canals were filled in the same session by active lateral condensation of the cones and sealers: Intrafill, AH Plus, Roeko Seal and Resilon/Epiphany System. After 90 days, the animals were euthanized and the tissues to be evaluated were processed and stained with hematoxylin and eosin. For histopathological analysis, the following parameters were evaluated: inflammatory process, mineralized tissue resorption, and apical mineralized tissue deposition. Histopathological analysis demonstrated that Intrafill had less favorable results in terms of apical and periapical repair, compared to the other sealers (p<0.05). AH Plus, Roeko Seal, and Epiphany sealers had similar and satisfactory results (p>0.05). In conclusion, AH Plus and the materials Roeko Seal and Epiphany are good options for clinical use in Endodontics.