Effects Of Sterilization Methods On The Physical, Chemical, And Biological Properties Of Silk Fibroin Membranes.

Silk fibroin has been widely explored for many biomedical applications, due to its biocompatibility and biodegradability. Sterilization is a fundamental step in biomaterials processing and it must not jeopardize the functionality of medical devices. The aim of this study was to analyze the influence of different sterilization methods in the physical, chemical, and biological characteristics of dense and porous silk fibroin membranes. Silk fibroin membranes were treated by several procedures: immersion in 70% ethanol solution, ultraviolet radiation, autoclave, ethylene oxide, and gamma radiation, and were analyzed by scanning electron microscopy, Fourier-transformed infrared spectroscopy (FTIR), X-ray diffraction, tensile strength and in vitro cytotoxicity to Chinese hamster ovary cells. The results indicated that the sterilization methods did not cause perceivable morphological changes in the membranes and the membranes were not toxic to cells. The sterilization methods that used organic solvent or an increased humidity and/or temperature (70% ethanol, autoclave, and ethylene oxide) increased the silk II content in the membranes: the dense membranes became more brittle, while the porous membranes showed increased strength at break. Membranes that underwent sterilization by UV and gamma radiation presented properties similar to the nonsterilized membranes, mainly for tensile strength and FTIR results.

Value Of Sentinel Lymph Node Biopsy In Papillary Thyroid Cancer: Initial Results Of A Prospective Trial.

The objectives of the study were to evaluate the performance of sentinel lymph node biopsy (SLNB) in detecting occult metastases in papillary thyroid carcinoma (PTC) and to correlate their presence to tumor and patient characteristics. Twenty-three clinically node-negative PTC patients (21 females, mean age 48.4 years) were prospectively enrolled. Patients were submitted to sentinel lymph node (SLN) lymphoscintigraphy prior to total thyroidectomy. Ultrasound-guided peritumoral injections of (99m)Tc-phytate (7.4 MBq) were performed. Cervical single-photon emission computed tomography and computed tomography (SPECT/CT) images were acquired 15 min after radiotracer injection and 2 h prior to surgery. Intra-operatively, SLNs were located with a gamma probe and removed along with non-SLNs located in the same neck compartment. Papillary thyroid carcinoma, SLNs and non-SLNs were submitted to histopathology analysis. Sentinel lymph nodes were located in levels: II in 34.7 % of patients; III in 26 %; IV in 30.4 %; V in 4.3 %; VI in 82.6 % and VII in 4.3 %. Metastases in the SLN were noted in seven patients (30.4 %), in non-SLN in three patients (13.1 %), and in the lateral compartments in 20 % of patients. There were significant associations between lymph node (LN) metastases and the presence of angio-lymphatic invasion (p = 0.04), extra-thyroid extension (p = 0.03) and tumor size (p = 0.003). No correlations were noted among LN metastases and patient age, gender, stimulated thyroglobulin levels, positive surgical margins, aggressive histology and multifocal lesions. Sentinel lymph node biopsy can detect occult metastases in PTC. The risk of a metastatic SLN was associated with extra-thyroid extension, larger tumors and angio-lymphatic invasion. This may help guide future neck dissection, patient surveillance and radioiodine therapy doses.

[preservation Of The Fertility And The Ovaries In Women With Benign Adnexal Tumors].

To evaluate the sparing of fertility and ovaries in women submitted to surgical treatment for benign adnexal tumors. Between February 2010 and January 2014, 206 patients were included in this observational study as they were submitted to surgical treatment for benign ovarian tumors at CAISM, a tertiary hospital. Fertility sparing surgery was defined as tumorectomy or unilateral salpingoophorectomy without hysterectomy in premenopausal women. Preservation of the ovary occurred when at least one ovary or part of it was mantained. Of the 206 women with benign tumors, 120 (58%) were premenopausal and 86 (42%) were postmenopausal. There were 36 (30%) ovarian germ cell tumors, 31 (26%) epithelial neoplasms and 11 (9%) sex-cord stromal tumors among premenopausal women. In the group of postmenopausal women, 35 (41%) epithelial neoplasms, 27 (31%) sex-cord stromal tumors and 8 (9%) ovarian germ cell tumors were identified. Among 36 women with non-neoplastic ovarian tumors, 21 (58%) had endometriomas and 8 (22%) functional cysts. Among 22 women with extra-ovarian tumors, uterine leiomyomatosis was the most frequent finding (50%). In the group of women who were ≤ 35 years old, 26 (57%) were treated by tumorectomy and 18 (39%) were submitted to unilateral salpingoophorectomy with sparing of the uterus and the contralateral ovary. Women who were ≤ 35 years old were more frequently operated by laparoscopy which was associated with a higher number of fertility sparing procedures when compared to laparotomy (p<0.01). Twenty-six (28%) women submitted to hysterectomy with bilateral salpingoophorectomy were premenopausal. Although there is a trend to perform only tumorectomy in women who are ≤ 35 years old, a significant number of young women is still treated by salpingoophorectomy. Among 36- to 45-year-old women, only 70% had their fertility spared, while 20% had both ovaries removed. However, whenever possible, we must try to preserve the ovaries, mainly in premenopausal women.

Transition From Glass To Digital Slide Microscopy In The Teaching Of Oral Pathology In A Brazilian Dental School.

Several medical and dental schools have described their experience in the transition from conventional to digital microscopy in the teaching of general pathology and histology disciplines; however, this transitional process has scarcely been reported in the teaching of oral pathology. Therefore, the objective of the current study is to report the transition from conventional glass slide to virtual microscopy in oral pathology teaching, a unique experience in Latin America. An Aperio ScanScope® scanner was used to digitalize histological slides used in practical lectures of oral pathology. The challenges and benefits observed by the group of Professors from the Piracicaba Dental School (Brazil) are described and a questionnaire to evaluate the students' compliance to this new methodology was applied. An improvement in the classes was described by the Professors who mainly dealt with questions related to pathological changes instead of technical problems; also, a higher interaction with the students was described. The simplicity of the software used and the high quality of the virtual slides, requiring a smaller time to identify microscopic structures, were considered important for a better teaching process. Virtual microscopy used to teach oral pathology represents a useful educational methodology, with an excellent compliance of the dental students.

Polycystic Ovary Syndrome And Chronic Autoimmune Thyroiditis.

Polycystic ovary syndrome (PCOS) has been associated with an autoimmune origin, either per se or favoring the onset of autoimmune diseases, from a stimulatory action on the inflammatory response. Thus, autoimmune thyroiditis (AIT) could be more prevalent among women with PCOS. To evaluate the prevalence of AIT in women with PCOS. It was a cross-sectional study, in a tertiary center, including 65 women with PCOS and 65 women without this condition. Clinical and laboratory parameters were evaluated and a thyroid ultrasound scan was performed. Levels of thyroid-stimulating hormone (TSH), free thyroxine (FT4), free triiodothyronine (FT3), anti-thyroid peroxidase (anti-TPO) antibodies, anti-thyroglobulin (anti-TG) antibodies, and thyroid ultrasound findings were evaluated. The prevalence of subclinical hypothyroidism (SCH) in women with PCOS was 16.9% and 6.2% in the non-PCOS group. AIT was more common in the PCOS group compared with the non-PCOS group (43.1% versus 26.2%). But, when it was adjusted by weight and insulin resistance, the difference in the thyroiditis risk was not observed (OR 0.78, CI 0.28-2.16). AIT risk was similar in the PCOS and the non-PCOS group. SCH are more common in women with PCOS, highlighting a need for periodic monitoring of thyroid function.

Taxonomic value of foliar characters in Dahlstedtia Malme: Leguminosae, Papilionoideae, Millettieae

Dahlstedtia Malme (Leguminosae) is a neotropical genus, native to the Brazilian Atlantic Forest, and comprises two species, D. pinnata (Benth.) Malme and D. pentaphylla (Taub.) Burk., although it has been considered a monotypic genus by some authors. Leaf anatomy was compared to verify the presence of anatomical characters to help delimit species. Foliar primordium, leaflet, petiolule, petiole and pulvinus were collected from cultivated plants (Campinas, SP, Brazil) and from natural populations (Picinguaba, Ubatuba and Caraguatatuba, SP, Brazil - D. pinnata; Antonina, PR, Brazil - D. pentaphylla). Studies on leaflet surface assessment (Scanning Electron Microscopy), as well as histology and venation analyses were carried out of dehydrated, fresh and fixed material from two species. Leaflet material was macerated for stomatal counts. Histological sections, obtained by free-hand cut or microtome, were stained with Toluidine Blue, Safranin/Alcian Blue, Ferric Chloride, Acid Phloroglucin. Secretory cavities are present in the lamina, petiolule, petiole, pulvinus and leaf primordium in D. pentaphylla, but not in D. pinnata, and can be considered an important character for species diagnosis. Other leaf characters were uninformative in delimiting Dahlstedtia species. There is cambial activity in the petiolule, petiole and pulvinus. This study, associated with other available data, supports the recognition of two species in Dahlstedtia.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Crown-down preflaring in the determination of the first apical file

In this study, scanning electron microscopy (SEM) was used to evaluate the adaptation of the first apical file after preflaring in mesiobuccal (MB) and mesiolingual (ML) canals of mandibular molars considering the tactile sensibility as a reference. The mesial canals (n = 22) of human mandibular molar teeth were used, and the first instrument to bind to the working length was determined after preflaring and crown-down shaping. Digital images of the root apex were acquired and a single examiner determined the contact of the file with the walls using Image J software. The results showed that the file was in contact in 47.83% and 31.71% in the MB and ML canals, respectively. When the apexes are fused, the average was 40.03%. A descriptive analysis showed that the first apical file did not touch all dentin walls in any of the samples.

Microlithiasis of the gallbladder: role of endoscopic ultrasonography in patients with idiopathic acute pancreatitis

OBJECTIVES: Causes may be found in most cases of acute pancreatitis, however no etiology is found by clinical, biological and imaging investigations in 30% of these cases. Our objective was to evaluate results from endoscopic ultrasonography (EUS) for diagnosis of gallbladder microlithiasis in patients with unexplained (idiopathic) acute pancreatitis. METHODS: Thirty-six consecutive non-alcoholic patients with diagnoses of acute pancreatitis were studied over a five-year period. None of them showed signs of gallstones on transabdominal ultrasound or tomography. We performed EUS within one week of diagnosing acute pancreatitis. Diagnosis of gallbladder microlithiasis on EUS was based upon findings of hyperechoic signals of 0.5-3.0 mm, with or without acoustic shadowing. All patients (36 cases) underwent cholecystectomy, in accordance with indication from the attending physician or based upon EUS diagnosis. RESULTS: Twenty-seven patients (75%) had microlithiasis confirmed by histology and nine did not (25%). EUS findings were positive in twenty-five. Two patients had acute cholecystitis diagnosed at EUS that was confirmed by surgical and histological findings. In two patients, EUS showed cholesterolosis and pathological analysis disclosed stones not detected by EUS. EUS diagnosed microlithiasis in four cases not confirmed by surgical treatment. In our study, sensitivity, specificity and positive and negative predictive values to identify gallbladder microlithiasis (with 95% confidence interval) were 92.6% (74.2-98.7%), 55.6% (22.7-84.7%), 86.2% (67.4-95.5%) and 71.4% (30.3-94.9%), respectively. Overall EUS accuracy was 83.2%. CONCLUSIONS: EUS is a very reliable procedure to diagnose gallbladder microlithiasis and should be used for the management of patients with unexplained acute pancreatitis. This procedure should be part of advanced endoscopic evaluation.

Origin of successive cambia on stem in three species of Menispermaceae

The lianas observed in this study, Abuta convexa (Vell.) Diels, Abuta imene (Mart.) Eichler, and Chondrodendron platiphyllum (A. St.-Hil.) Miers, all have successive cambia in their stems. The terminology applied to stem histology in species with successive cambia is as diverse as the interpretations of the origins of this cambial variant. Therefore, this study specifically investigates the origin of successive cambia through a developmental analysis of the above-mentioned species, including an analysis of the terminology used to describe this cambial variation. For the first time, we have identified several developmental stages giving rise to the origins of successive cambia in this family. First, the pericycle originates in 1-3 layers of conjunctive tissue. After the differentiation of the first ring, the conjunctive tissue undergoes new divisions, developing approximately 10 rows of parenchyma cells. In the middle portion, a layer of sclereids is formed, again subdividing the conjunctive tissue into two parts: internal and external. New cambia originate in the internal part, from which new secondary vascular strands will originate, giving rise to the second successive vascular ring of the stem. The external part remains parenchymatous during the installation of the second ring and will undergo new periclinal division, repeating the entire process. New cambia will originate from the neoformed strands, which will form only rays. In the literature, successive cambia are formed by a meristem called "diffuse lateral meristem."However, based on the species of Menispermaceae studied in this report, it is demonstrated that the diffuse lateral meristem is the pericycle itself.

Constituents and antiproliferative activity of extracts from leaves of Croton macrobothrys

Croton macrobothrys Baill, Euphorbiaceae, is a tree from the Atlantic Forest in Southern Brazil, used in traditional medicine and popularly known as "dragon's blood" and "pau-sangue". Leaf n-hexane, dichloromethane and methanol extracts were analyzed by GC/MS and evaluated for their in vitro antiproliferative activity on cell lines 786-0 (kidney), HT-29 (colon), K562 (leukemia), NCI-ADR/RES (drug resistant ovary), NCI-H460 (lung), MCF-7 (mammary), PC-3 (prostate), OVCAR-3 (ovary), U251 (glioma) and UACC-62 (melanoma). The dicloromethane extract exhibited activity against all cell lines at the concentration 25 µg/mL, in particular on cell lines NCI-H460 (GI50 0.33 μg/mL) and K5662 (GI50 0.91 μg/mL). Relevant constituents in dichloromethane extract are the alkaloids corydine and salutaridine, as well as the diterpenes geranylgeraniol and crotonin-derived clerodanes.

Effects of uterine cervix constriction on Wistar rats

PURPOSE: To verify if uterine cerclage can induce craniosynostosis or any cranial deformity in new born Wistar rats. METHODS: One pregnant female Wistar rat underwent laparotomy on day 18 of gestation and the uterus cervix was closed with a 3-0 nylon suture to avoid delivery, that occurs normally on the 21 day. The suture was released after 48 hours beyond the normal gestation period. The female rat delivered 11 pups. Six surviving rats from the delivery (group A - constrained group). Two rats were born from another mother and in the same age were used as control group (group B - 2 nonconstrained controls) were allowed to grow. They were sacrificed 1.2 years after their birth all the eight animals. Linear measurement, routine histology and computed tomography of the skull were performed at the time of their death to evaluate the cranial asymmetries by mesurements of the anatomical landmarks of the craniofacial skeleton of the rats on the two groups and compared then. RESULTS: We did not observe statistically significant differences in any of the compared measurements (p>0.05) obtained through the morphologic and radiologic methods. Histologic examinations did not reveal any sign of premature fusion or suture imbrications. Critical decrease in longitudinal body size was noticed as the limbs too in all the animals of group A. CONCLUSION: Constriction of uterine cervix leads to fetus suffering, even death for a few animals, associated to small body size, but not to craniosynostosis.

Evaluation of the effects of ozone therapy in the treatment of intra-abdominal infection in rats

INTRODUCTION: The antibacterial effect of ozone (O3) has been described in the extant literature, but the role of O3 therapy in the treatment of certain types of infection remains controversial. OBJECTIVES: To evaluate the effect of intraperitoneal (i.p.) O3 application in a cecal ligation/puncture rat model on interleukins (IL-6, IL-10) and cytokine-induced neutrophil chemoattractant (CINC)-1 serum levels, acute lung injury and survival rates. METHODS: Four animal groups were used for the study: a) the SHAM group underwent laparotomy; b) the cecal ligation/puncture group underwent cecal ligation/puncture procedures; and c) the CLP+O2 and CLP+O3 groups underwent CLP+ corresponding gas mixture infusions (i.p.) throughout the observation period. IL-6, CINC-1 and IL-10 concentrations were determined by enzyme-linked immunosorbent assay (ELISA). Acute lung injury was evaluated with the Evans blue dye lung leakage method and by lung histology. P<0.05 was considered significant. RESULTS: CINC-1 was at the lowest level in the SHAM group and was lower for the CLP+O3 group vs. the CLP+O2 group and the cecal ligation/puncture group. IL-10 was lower for the SHAM group vs. the other three groups, which were similar compared to each other. IL-6 was lower for the SHAM group vs. all other groups, was lower for the CLP+O3 or CLP+O2 group vs. the cecal ligation/puncture group, and was similar for the CLP+O3 group vs. the CLP+O2 group. The lung histology score was lower for the SHAM group vs. the other groups. The Evans blue dye result was lower for the CLP+O3 group vs. the CLP+O2 group and the cecal ligation/puncture group but similar to that of the SHAM group. The survival rate for the CLP+O3 group was lower than for the SHAM group and similar to that for the other 2 groups (CLP and CLP+O2). CONCLUSION: Ozone therapy modulated the inflammatory response and acute lung injury in the cecal ligation/puncture infection model in rats, although there was no improvement on survival rates.

Keratoconus prediction using a finite element model of the cornea with local biomechanical properties

PURPOSE: The ability to predict and understand which biomechanical properties of the cornea are responsible for the stability or progression of keratoconus may be an important clinical and surgical tool for the eye-care professional. We have developed a finite element model of the cornea, that tries to predicts keratoconus-like behavior and its evolution based on material properties of the corneal tissue. METHODS: Corneal material properties were modeled using bibliographic data and corneal topography was based on literature values from a schematic eye model. Commercial software was used to simulate mechanical and surface properties when the cornea was subject to different local parameters, such as elasticity. RESULTS: The simulation has shown that, depending on the corneal initial surface shape, changes in local material properties and also different intraocular pressures values induce a localized protuberance and increase in curvature when compared to the remaining portion of the cornea. CONCLUSIONS: This technique provides a quantitative and accurate approach to the problem of understanding the biomechanical nature of keratoconus. The implemented model has shown that changes in local material properties of the cornea and intraocular pressure are intrinsically related to keratoconus pathology and its shape/curvature.