953 resultados para Environmental impact consultants
Resumo:
Building's construction activities, operation and demolition are increasingly recognised as a major source of environmental impact. One strategy for reducing such impacts is most widely known by the term Building Environmental Assessment (BEA). The research is an attempt to develop a new BEA scheme for residential buildings in Brunei which focussing on identifying BEA indicators that best suit for Brunei environment, social and economy. Studies show that Brunei residential sector needs urgent attention to transform its current consumption rate in more sustainable way. Recent launch of Brunei Green Building Council, mandatory energy efficiency guidelines and declaration of ambitious energy intensity reduction target, a new BEA scheme will help contribute sustainability target in residential sector. However the issues of developing a new BEA schemes using existing methods may face constraints in their effectiveness. In this regard, a consensus-forming technique-Delphi method-helps improve greater communication and gain consensus from experts in the construction industry through series of questionnaires. As a result, the final framework is produced comprises of 7 key categories and 37 applicable criteria that achieved high degree of consensus and importance.
Resumo:
Dairy cattle farms have a well-known environmental impact that affects all ecological compartments: air, soil, water and biosphere [1]. Dairy cattle farming are a significant source of anthropogenic gases from enteric fermentation, manure storage and land application, mainly ammonia (NH3), nitric oxide (NO), nitrous oxide (N2O), carbon dioxide (CO2) and methane (CH4). The emission of such gases represents not only an environmental problem but also leads to energy and nitrogen (N) losses in ruminant production systems [2-5]. Several efforts are required on the development of new technologies and strategies that mitigate gaseous emissions, N losses and improve the efficiency of the energy and N cycles [6, 7]. In the Northwest of Portugal, dairy cattle production has a major impact on the economy, with strong repercussions at national scale. Therefore, our Ph.D. thesis project aims to: a) Study natural supplements as additives in the dairy cattle diet towards a decrease in GHG emissions from feeding operations; b) Compare commercial dairy cattle diets with and without additives on gaseous emissions from manure deposited in a simulated concrete floor; c) Assess the concentrations and emissions of NH3 and greenhouse gases from commercial dairy cattle facilities; d) Evaluate the effects of different additives on lowering gaseous emissions from dairy cattle excreta, using a laboratory system simulating a dairy house concrete floor.
Resumo:
2016
Resumo:
During the PhD program in chemistry at the University of Bologna, the environmental sustainability of some industrial processes was studied through the application of the LCA methodology. The efforts were focused on the study of processes under development, in order to assess their environmental impacts to guide their transfer on an industrial scale. Processes that could meet the principles of Green Chemistry have been selected and their environmental benefits have been evaluated through a holistic approach. The use of renewable sources was assessed through the study of terephthalic acid production from biomass (which showed that only the use of waste can provide an environmental benefit) and a new process for biogas upgrading (whose potential is to act as a carbon capture technology). Furthermore, the basis for the development of a new methodology for the prediction of the environmental impact of ionic liquids has been laid. It has already shown good qualities in identifying impact trends, but further research on it is needed to obtain a more reliable and usable model. In the context of sustainable development that will not only be sector-specific, the environmental performance of some processes linked to the primary production sector has also been evaluated. The impacts of some organic farming practices in the wine production were analysed, the use of the Cereal Unit parameter was proposed as a functional unit for the comparison of different crop rotations, and the carbon footprint of school canteen meals was calculated. The results of the analyses confirm that sustainability in the industrial production sector should be assessed from a life cycle perspective, in order to consider all the flows involved during the different phases. In particular, it is necessary that environmental assessments adopt a cradle-to-gate approach, to avoid shifting the environmental burden from one phase to another.
Resumo:
Antimicrobials, among other veterinary drugs, are used worldwide in industry and agriculture to protect animal health and prevent economic loss. In recent years, they have been detected in various environmental compartments, including soil, surface and groundwater and have become a topic of research interest. Emphasizing this class of compounds, this review presents the different pathways which veterinary drugs enter in the environment, in particular contaminate soils. Also are presented regulatory aspects and guidelines, adsorption/desorption and degradation of these compounds in soils and the consequences of its dispersal in the environment.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.
Resumo:
Growing knowledge on the health-promoting impact of antioxidants in everyday foods, combined with the assumption that a number of common synthetic preservatives may have hazardous side effects has led to increased investigations in the field of natural antioxidants, principally those found in plants. Food industries normally discard plant residues that could benefit the human health and diminish undesirable environmental impact. Once estimated the content of antioxidants in these residues, advantageous economical and social alternatives to the discard are possible, for example, their use for preparation of nutraceuticals to be offered to low-income populations. We present here a broad, although not complete, account of the continuously growing knowledge on the antioxidant capacity of whole fruits, seeds and peels, cereals, vegetal oils and aromatic plants, at several physical forms, as well as a description of the usual methods for evaluating their antioxidant capacity and examples of agroindustrial processes that could be harnessed for the production of antioxidant supplement food, along with research perspectives in the area.
Resumo:
Faz-se, por meio de uma abordagem ambiental histórico-dialética, a caracterização dos processos auríferos desenvolvidos no município de Faina, Goiás. São analisadas três atividades: mineração escrava, mineração de dragagem e mineração industrial. Evidenciou-se que a exploração por dragagem tem um maior poder impactante. Sobretudo, a mineração aurífera em Faina contribuiu para a história ambiental local e para o resgate dessa no Brasil.
Resumo:
Bees are considered one of the most efficient pollinators. Therefore, they have Indisputable role in the plants reproduction, since they increase the quality and quantity of fruit and seeds, and thus they help the ecosystems maintenance. Cerrado is one of the most affected ecosystems due to the growth of human activities, drastically reducing its biodiversity. The faunistic analysis identifies the species and the size of the populations, and can also indicate the degree of environmental Impact on a particular area. Surveys on flower-visiting hymenoptera in a cerradao area, with 40ha, in the Experimental Station of Itiparina (SP), were conducted every fifteen days from March 2003 to February 2004. From 181 insects collected, the Apidae family was represented by the largest number of species and individuals. The species Apis mellifera (55.8%), Trigona spinipes (14.4%) and Exomalopsis (Exomalopsis) sp. (8.3%) were the most prevalent fit the area. Among the bees species collected, 30.8% were classified as sociable and 69.2% as solitary. Considering all hymenoptera collected, 59.7% preferred the morning period and 40.3% the afternoon period for foraging and/or visiting. The Diversity index (Shannon-Wiener) H was 1.6933, V(H) = 0.0123 and Uniformity index E = 0.5652, following pattern found in other areas of cerrado.
Resumo:
The main objective of this study was to evaluate the potential application of a lightweight concrete produced with lightweight coarse aggregate made of the water treatment sludge and sawdust (lightweight composite), by determining the thermal properties and possible environmental impact of future residue of this concrete. Two types of concrete were prepared: concrete produced with the lightweight composite dosed with cement/sand/composite/water in a mass ratio of 1:2.5:0.67:0.6 and conventional concrete dosed with cement/sand/crushed stone/water in a mass ratio of 1:4.8:5.8:0.8. The thermal properties were determined by the hot wire parallel technique. The possible environmental impact was measured using the procedures and guidelines of the Brazilian Association of Technical Standards - ABNT. The concrete produced with the lightweight composite presented a 23% lower thermal conductivity than the conventional concrete. The concrete produced with the lightweight composite presented a set of thermal properties suitable for the application of this concrete in non-structural sealing elements. The concentration of aluminum in the solubilized extract of the concrete produced with the lightweight composite was much lower than the concentration of aluminum in the water treatment sludge, confirming the possible reduction of environmental impact of this composite for use in concrete. (C) 2010 Elsevier Ltd. All rights reserved.
Resumo:
Understanding the product`s `end-of-life` is important to reduce the environmental impact of the products` final disposal. When the initial stages of product development consider end-of-life aspects, which can be established by ecodesign (a proactive approach of environmental management that aims to reduce the total environmental impact of products), it becomes easier to close the loop of materials. The `end-of-life` ecodesign methods generally include more than one `end-of-life` strategy. Since product complexity varies substantially, some components, systems or sub-systems are easier to be recycled, reused or remanufactured than others. Remanufacture is an effective way to maintain products in a closed-loop, reducing both environmental impacts and costs of the manufacturing processes. This paper presents some ecodesign methods focused on the integration of different `end-of-life` strategies, with special attention to remanufacturing, given its increasing importance in the international scenario to reduce the life cycle impacts of products. (C) 2009 Elsevier Ltd. All rights reserved.
Resumo:
An assessment is made of the atmospheric emissions from the life cycle of fuel ethanol coupled with the cogeneration of electricity from sugarcane in Brazil. The total exergy loss from the most quantitative relevant atmospheric emission substances produced by the life cycle of fuel ethanol is 3.26E+05 kJ/t of C(2)H(5)OH, Compared with the chemical exergy of 1 t of ethanol (calculated as 34.56E + 06 kJ). the exergy loss from the life cycle`s atmospheric emission represents 1.11% of the product`s exergy. The activity that most contributes to atmospheric emission chemical exergy losses is the harvesting of sugarcane through the methane emitted in burning. Suggestions for improved environmental quality and greater efficiency of the life cycle of fuel ethanol with cogenerated energy are: harvesting the sugarcane without burning, renewable fuels should be used in tractors, trucks and buses instead of fossil fuel and the transportation of products and input should be logistically optimized. (C) 2009 Elsevier Ltd. All rights reserved.
Resumo:
Commercial farming of carnivorous fish demands the reduction of environmental impact of feeds; that requires minimal use of dietary animal protein. This study investigated the digestibility of diets formulated exclusively out of plant protein, added feed attractants, by the carnivore largemouth bass, Micropterus salmoides. Juvenile largemouth bass (14.0 +/- 1.0 cm) conditioned to accept artificial, dry feed were confined in polypropylene cages and fed ad libitum in three daily meals, seven experimental diets containing varying levels of vegetable and animal protein sources, added of different feed stimulants. After last daily meal, cages were transferred to cylindrical-conical-bottomed, 200-L aquaria, where faeces were collected by sedimentation into refrigerated containers, preserved and later analysed for chemical composition. Soybean meal can be used as partial substitute of animal protein in diets for largemouth bass; the poultry by-product meal shows as a good option as animal protein source in these rations. Control treatment - 50PP : 50AP - yielded best performances; the need for the use of fish meal in the formulation for carnivorous diets is, at least, questionable. Results of the digestibility trials demonstrated the importance of determining the diet digestibility, if precision in the formulation of least-cost feeds for carnivorous fish is the ultimate goal.
Resumo:
In natural estuaries, contaminant transport is driven by the turbulent momentum mixing. The predictions of scalar dispersion can rarely be predicted accurately because of a lack of fundamental understanding of the turbulence structure in estuaries. Herein detailed turbulence field measurements were conducted at high frequency and continuously for up to 50 hours per investigation in a small subtropical estuary with semi-diurnal tides. Acoustic Doppler velocimetry was deemed the most appropriate measurement technique for such small estuarine systems with shallow water depths (less than 0.5 m at low tides), and a thorough post-processing technique was applied. The estuarine flow is always a fluctuating process. The bulk flow parameters fluctuated with periods comparable to tidal cycles and other large-scale processes. But turbulence properties depended upon the instantaneous local flow properties. They were little affected by the flow history, but their structure and temporal variability were influenced by a variety of mechanisms. This resulted in behaviour which deviated from that for equilibrium turbulent boundary layer induced by velocity shear only. A striking feature of the data sets is the large fluctuations in all turbulence characteristics during the tidal cycle. This feature was rarely documented, but an important difference between the data sets used in this study from earlier reported measurements is that the present data were collected continuously at high frequency during relatively long periods. The findings bring new lights in the fluctuating nature of momentum exchange coefficients and integral time and length scales. These turbulent properties should not be assumed constant.
Resumo:
This paper reviews a wide range of tools for comprehensive sustainability assessments at whole tourism destinations, covering socio-cultural, economic and environmental issues. It considers their strengths, weaknesses and site specific applicability. It is intended to facilitate their selection (and combination where necessary). Tools covered include Sustainability Indicators, Environmental Impact Assessment, Life Cycle Assessment, Environmental Audits, Ecological Footprints, Multi-Criteria Analysis and Adaptive Environmental Assessment. Guidelines for evaluating their suitability for specific sites and situations are given as well as examples of their use.