Mannan-binding lectin MBL2 gene polymorphism in chronic hepatitis C: association with the severity of liver fibrosis and response to interferon therapy

Hepatitis C virus (HCV) is a major cause of hepatic disease and of liver transplantation worldwide. Mannan-binding lectin (MBL), encoded by the MBL2 gene, can have an important role as an opsonin and complement activating molecule in HCV persistence and liver injury. We assessed the MBL2 polymorphism in 102 Euro-Brazilian patients with moderate and severe chronic hepatitis C, paired for gender and age with 102 HCV seronegative healthy individuals. Six common single nucleotide polymorphisms in the MBL2 gene, three in the promoter (H/L, X/Y and P/Q) and three in exon 1 (A, the wild-type, and B, C or D also known as O) were evaluated using real-time polymerase chain reaction with fluorescent hybridization probes. The concentration of MBL in plasma was measured by enzyme-linked immunosorbent assay. The frequency of the YA/YO genotype was significantly higher in the HCV patients compared with the controls (P = 0.022). On the other hand, the genotypes associated with low levels of MBL (XA/XA, XA/YO and YO/YO) were decreased significantly in the patients with severe fibrosis (stage F4), when compared with the patients with moderate fibrosis (stage F2) (P = 0.04) and to the control group (P = 0.011). Furthermore, MBL2 genotypes containing X or O mutations were found to be associated with non-responsiveness to pginterferon and ribavirin treatment (P = 0.023). MBL2 polymorphisms may therefore be associated not only with the development of chronic hepatitis C, but also with its clinical evolution and response to treatment.

The degree of external genitalia virilization in girls with 21-hydroxylase deficiency appears to be influenced by the CAG repeats in the androgen receptor gene

Background Women with 21-hydroxylase deficiency present much variability in external genitalia virilization, even among those with similar impairments of 21-hydroxylase (21OH) activity. Objective To evaluate if the number of CAG (nCAG) repeats of the androgen receptor gene influences the degree of external genitalia virilization in women with CYP21A2 mutations, grouped according to impairment of 21OH activity. Patients The nCAG was determined in 106 congenital adrenal hyperplasia (CAH) patients and in 302 controls. The patients were divided, according to their CYP21A2 genotypes, into Groups A and B, which confer total and severe impairment of 21OH activity, respectively. Methods The inactivation pattern of the X-chromosome was studied through genomic DNA digestion with Hpa II. The CAG repeat region was amplified by polymerase chain reaction (PCR) and analysed by GeneScan. Results The nCAG and the frequency of severe skewed X-inactivation did not differ between normal women and patients. The nCAG median in genotype A was 20.7 (IQR 2.3) for Prader I + II, 22.5 (3.6) for Prader III and 21 (2.9) for Prader IV + V (P < 0.05 for Prader III and Prader IV + V). The nCAG median in genotype B was 21.3 (1.1) for Prader I + II, 20.5 (2.9) for Prader III and 22 (2.8) for Prader IV + V (P > 0.05). A significant difference was found regarding the nCAG median in patients presenting Prader III from genotypes A and B. Conclusions We observed great variability in the degree of external genitalia virilization in both CYP21A2 genotypes, and we showed that the CAG repeats of the androgen receptor gene influences this phenotypic variability.

The Role of SRY Mutations in the Etiology of Gonadal Dysgenesis in Patients with 45,X/46,XY Disorder of Sex Development and Variants

Background: The potential involvement of SRY in abnormal gonadal development in 45,X/46,X,der(Y) patients was proposed following the identification of SRY mutations in a few patients with Turner syndrome (TS). However, its exact etiological role in gonadal dysgenesis in patients with Y chromosome mosaicisms has not yet been clarified. Aims: It was the aim of this study to screen for allelic variation in SRY in a large cohort of patients with disorders of sex development due to chromosomal abnormalities with 45, X/46, X, der(Y) karyotype. Patients: Twenty-seven patients, 14 with TS and 13 with mixed gonadal dysgenesis (MGD), harboring 45, X/46, X, der(Y) karyotypes were selected. Methods: Genomic DNA was extracted from peripheral blood leukocytes of all patients and from gonadal tissue in 4 cases. The SRY coding region was PCR amplified and sequenced. Results: We identified only 1 polymorphism (c.561C -> T) in a 45,X/46,XY MGD patient, which was detected in blood and in gonadal tissue. Conclusion: Our results indicate that mutations in SRY are rare findings in patients with Y chromosome mosaicisms. Therefore, a significant role of mutated SRY in the etiology of gonadal dysgenesis in patients harboring 45, X/46, XY karyotype and variants seems very unlikely. Copyright (C) 2010 S. Karger AG, Basel

Absence of GH-Releasing Hormone (GHRH) Mutations in Selected Patients with Isolated GH Deficiency

Context: Although numerous reports of mutations in GH1 and GHRHR (GHRH receptor) causing isolated GH deficiency (IGHD) have been published, mutations in GHRH itself have not been hitherto reported but are obvious candidates for GH deficiency. Objective: The aim of this study was to identify mutations in GHRH in a large cohort of patients with IGHD. Patients and Methods: DNA was isolated from 151 patients diagnosed with IGHD at national and international centers. Seventy-two patients fulfilled all the following criteria: severe short stature (height SD score <= -2.5), low peakGHafter stimulation (peak <= 5 ng/ml), eutopic posterior pituitary lobe, and absence of mutations in GH1 and GHRHR and therefore were strong candidates for GHRH mutations. The coding sequence and splice sites of GHRH were amplified by PCR with intronic primers and sequenced. Results: In five of 151 patients (four of 42 from Brazil), the GHRH c. 223 C>T, p. L75F change was identified in heterozygosity. This variant has been previously reported as a polymorphism and is more frequent in African than European and Asian populations. Six allelic variants (five novel) that do not predict change of amino acids or splice sites were identified in five patients: c. 147 C>T, p.S49S, IVS1 -70 G>A, IVS1 -74 T>C, IVS3 -47 del1, and IVS3 +7 G>A/IVS3 + 41 G>A. No functional mutations were found in this cohort. Conclusions: GHRH mutations were not identified in a selected cohort of patients with IGHD, suggesting that, if they exist, they may be an extremely rare cause of IGHD. Other, as-yet-unidentified genetic factors may be implicated in the genetic etiology of IGHD in our cohort. (J Clin Endocrinol Metab 96: E1457-E1460, 2011)

A tale of two terminators: Crystal structures sharpen the debate on DNA replication fork arrest mechanisms

The structure of the Tus-Ter DNA replication fork arrest complex of Escherichia coli reveals a novel architecture for the bound Tus protein and a new type of DNA-binding motif, The structure of the complex may explain how Tus can block movement of a replication fork approaching from one direction and not the other.

Human chromosomal fragile site FRA16B is an amplified AT-rich minisatellite repeat

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

Reorganization of terminator DNA upon binding replication terminator protein: Implications for the functional replication fork arrest complex

Termination of DNA replication in Bacillus subtilis involves the polar arrest of replication forks by a specific complex formed between the replication terminator protein (RTP) and DNA terminator sites. While determination of the crystal structure of RTP has facilitated our understanding of how a single RTP dimer interacts with terminator DNA, additional information is required in order to understand the assembly of a functional fork arrest complex, which requires an interaction between two RTP dimers and the terminator site. In this study, we show that the conformation of the major B. subtilis DNA terminator, Terl, becomes considerably distorted upon binding RTP. Binding of the first dimer of RTP to the B site of Terl causes the DNA to become slightly unwound and bent by similar to 40 degrees. Binding of a second dimer of RTP to the A site causes the bend angle to increase to similar to 60 degrees. We have used this new data to construct two plausible models that might explain how the ternary terminator complex can block DNA replication in a polar manner, in the first model, polarity of action is a consequence of the two RTP-DNA half-sites having different conformations. These different conformations result from different RTP-DNA contacts at each half-site (due to the intrinsic asymmetry at the terminator DNA), as well as interactions (direct or indirect) between the RTP dimers on the DNA. In the second model, polar fork arrest activity is a consequence of the different affinities of RTP for the A and B sites of the terminator DNA, modulated significantly by direct or indirect interactions between the RTP dimers.

The-2518 bp promoter polymorphism at CCL2/MCP1 influences susceptibility to mucosal but not localized cutaneous leishmaniasis in Brazil

Mucosal leishmaniasis (ML) follows localized cutaneous leishmaniasis (CL) caused by Leishmania braziliensis. Proinflammatory responses mediate CL self-healing but are exaggerated in ML Proinflammatory monocyte chemoattractant protein 1 (MCP-1; encoded by CCL2) is associated with CL We explore its role in CL/ML through analysis of the regulatory CCL2 -2518 bp promoter polymorphism in CL/ML population samples and families from Brazil. Genotype frequencies were compared among ML/CL cases and control groups using logistic regression and the family-based association test (FBAT). MCP-1 was measured in plasma and macrophages. The GG recessive genotype at CCL2 -2518 bp was more common in patients with ML (N = 67) than in neighborhood control (NC; N = 60) subjects (OR 1.78; 95% Cl 1.01-3.14; P = 0.045), than in NC combined with leishmanin skin-test positive (N = 60) controls (OR 4.40; 95% CI 1.42-13.65; P = 0.010), and than in controls combined with CL (N = 60) patients (OR 2.78; 95% CI 1.13-6.85; P = 0.045). No associations were observed for CL compared to any groups. FBAT (91 ML and 223 CL cases in families) confirmed recessive association of ML with allele G (Z = 2.679; P = 0.007). Higher levels of MCP-1 occurred in plasma (P = 0.03) and macrophages (P < 0.0001) from GG compared to AA individuals. These results suggest that high MCP-1 increases risk of ML (C) 2010 Elsevier B.V. All rights reserved.

A novel method for development of species and strain-specific DNA probes and PCR primers for identifying Burkholderia solanacearum (formerly Pseudomonas solanacearum)

Six Burkholderia solanacearum (formerly Pseudomonas solanacearum) genomic DNA fragments were isolated, using RAPD techniques and cloning, from the three genetically diverse strains: ACH092 (Biovar 4), ACH0158 (Biovar 2) and ACH0171 (Biovar 3) (1). One of these cloned fragments was selected because it was present constantly in all bacterial strains analysed. The remaining five clones were selected because Southern hybridisation revealed that each showed partial or complete specificity towards the strain of origin. A seventh genomic fragment showing a strain-specific distribution in Southern hybridisations was obtained by differential restriction, hybridisation and cloning of genomic DNA. Each of these clones was sequenced and primers to amplify the insert were designed. When DNA from the strain of origin was used as template, PCR amplification for each of these fragments yielded a single band on gel analysis. One pair of primers amplified the species-constant fragment of 281 bp from DNA of all B. solanacearum strains investigated, from DNA of the closely related bacterium which causes ''blood disease'' of banana (BDB) and in P. syzigii. The sensitivity of detection of B. solanacearum using these ubiquitous primers was between 1.3 and 20 bacterial cells. The feasibility and reliability of a PCR approach to detection and identification of B. solanacearum was tested in diverse strains of the bacterium in several countries and laboratories.

Association of the MCP-1-2518 A/G Polymorphism and No Association of Its Receptor CCR2-64 V/I Polymorphism with Lupus Nephritis

Objective. To evaluate whether the A/G polymorphism at position 2518 in the regulatory region of the monocyte chemoattractant protein-1 (MCP-1) or the V/I polymorphism at position 64 of the receptor. CCR2, are associated with lupus nephritis (LN) or any clinical characteristics of the disease or with renal survival in a patient population. Methods. We selected 197 patients with lupus nephritis and 220 matched healthy controls for study. MCP-1 and CCR2 genotyping was performed by polymerase chain reaction. Clinical and laboratory data were compiled from patients` charts over followup that ranged from 6 months to 10 years. Results. The GIG genotype of MCP-1 was more common in LN patients (p = 0.019), while the A allele was associated with healthy controls (p = 0.007) as was the V allele of CCR2 (p = 0.046) compared to LN patients. Clinical index measures [SLE Disease Activity Index (SLEDAI)], immunological markers, renal histology, renal function at enrollment, and renal survival were not influenced by these polymorphisms. A less aggressive renal disease, measured by renal SLEDAI index, was associated with the V allele of the CCR2 gene polymorphism. Conclusion. These findings support that MCP-1 2518 GIG is associated with LN but there was no association of this genotype with renal function or renal survival. When studying CCR2 64 V/I polymorphism we showed a positive association of the V allele with healthy controls but no association of the genotype with LN patients. (First Release March 152010; J Rheumatol 2010;37:776-82; doi:10.3899/jrheum.090681)

Metabolic activation of aromatic amines by human pancreas

Epidemiologic studies have suggested that aromatic amines (and nitroaromatic hydrocarbons) may be carcinogenic for human pancreas, Pancreatic tissues from 29 organ donors (13 smokers, 16 non-smokers) were examined for their ability to metabolize aromatic amines and other carcinogens, Microsomes showed no activity for cytochrome P450 (P450) 1A2-dependent N-oxidation of 4-aminobiphenyl (ABP) or for the following activities (and associated P450s): aminopyrine N-demethylation and ethylmorphine N-demethylation (P450 3A4); ethoxyresorufin O-deethylation (P450 1A1) and pentoxyresorufin O-dealkylation (P450 2B6); p-nitrophenol hydroxylation and N-nitrosodimethylamine N-demethylation (P450 2E1); lauric acid omega-hydroxylation (P450 4A1); and 4-(methylnitrosamino)-1-(3-pyridyl-1-butanol) (NNAL) and 4-(methylnitrosamino)1-(3-pyridyl)-1-butanone (NNK) alpha-oxidation (P450 1A2, 2A6, 2D6). Antibodies were used to examine microsomal levels of P450 1A2, 2A6, 2C8/9/18/19, 2E1, 2D6, and 3A3/ 4/5/7 and epoxide hydrolase. Immunoblots detected only epoxide hydrolase at low levels; P450 levels were <1% of liver. Microsomal benzidine/prostaglandin hydroperoxidation activity was low. In pancreatic cytosols and microsomes, 4-nitrobiphenyl reductase activities were present at levels comparable to human liver. The O-acetyltransferase activity (AcCoA-dependent DNA-binding of [H-3]N-hydroxy-ABP) of pancreatic cytosols was high, about two-thirds the levels measured in human colon. Cytosols showed high activity for N-acetylation of p-aminobenzoic acid, but not of sulfamethazine, indicating that acetyltransferase-1 (NAT1) is predominantly expressed in this tissue. Cytosolic sulfotransferase was detected at low levels. Using P-32-post-labeling enhanced by butanol extraction, putative arylamine-DNA adducts were detected in most samples. Moreover, in eight of 29 DNA samples, a major adduct was observed that was chromatographically identical to the predominant ABP-DNA adduct, N-(deoxyguanosin-8-yl)-ABP. These results are consistent with a hypothesis that aromatic amines and nitroaromatic hydrocarbons may be involved in the etiology of human pancreatic cancer.

A high-fat meal impairs muscle vasodilatation response to mental stress in humans with Glu27 beta(2)-adrenoceptor polymorphism

Background: Forearm blood flow responses during mental stress are greater in individuals homozygous for the Glu27 allele. A high-fat meal is associated with impaired endothelium-dependent dilatation. We investigated the impact of high-fat ingestion on the muscle vasodilatory responses during mental stress in individuals with the Glu27 allele and those with the Gln27 allele of the beta(2)-adrenoceptor gene. Methods: A total of 162 preselected individuals were genotyped for the Glu27Gln beta(2)-adrenoceptor polymorphism. Twenty-four individuals participated in the study. Fourteen were homozygous for the Gln27 allele (Gln27Gln, 40 +/- 2 years; 64 +/- 2 kg), and 10 were homozygous for the Glu27 allele (Glu27Glu, 40 +/- 3 years; 65 +/- 3 kg). Forearm blood flow was evaluated by venous occlusion plethysmography before and after ingestion of 62 g of fat. Results: The high-fat meal caused no changes in baseline forearm vascular conductance (FVC, 2.2 +/- 0.1 vs. 2.4 +/- 0.2; P = 0.27, respectively), but reduced FVC responses to mental stress (1.5 +/- 0.2 vs. 0.8 +/- 0.2 units; P = 0.04). When volunteers were divided according to their genotypes, baseline FVC was not different between groups (Glu27Glu = 2.4 +/- 0.1 vs. Gln27Gln = 2.1 +/- 0.1 units; P = 0.08), but it was significantly greater in Glu27Glu individuals during mental stress (1.9 +/- 0.4 vs. 1.0 +/- 0.3 units; P = 0.04). High-fat intake eliminated the difference in FVC responses between Glu27Glu and Gln27Gln individuals (FVC, 1.3 +/- 0.4 vs. 1.2 +/- 0.4; P = 0.66, respectively). Conclusion: These findings demonstrate that a high-fat meal impairs muscle vasodilatation responses to mental stress in humans. However, this reduction can be attributed to the presence of the homozygous Glu27 allele of the beta(2)-adrenoceptor gene.

Reciprocal interactions of obstructive sleep apnea and hypertension associated with ACE I/D polymorphism in males

Background: The angiotensin-converting enzyme (ACE) insertion/deletion (I/D) polymorphism gene contributes to the genesis of hypertension (HTN) and may help explain the relationship between obstructive sleep apnea (OSA) and HTN. However, ACE is a pleiotropic gene that has several influences, including skeletal muscle and control of ventilation. We therefore tested the hypothesis that ACE polymorphism influences OSA severity. Methods: Male OSA patients (apnea-hypopnea index [AHI] > 5 events/h) from 2 university sleep centers were evaluated by polysomnography and ACE I/D polymorphism genotyping. Results: We studied 266 males with OSA (age = 48 +/- 13y, body mass index = 29 5kg/m(2), AHI = 34 +/- 25events/h). HTN was present in 114 patients (43%) who were older (p < 0.01), heavier (p < 0.05) and had more severe OSA (p < 0.01). The I allele was associated with HTN in patients with mild to moderate OSA (p < 0.01), but not in those with severe OSA. ACE I/D polymorphism was not associated with apnea severity among normotensive patients. In contrast. the only variables independently associated with OSA severity among patients with hypertension in multivariate analysis were BMI (OR = 1.12) and 11 genotype (OR = 0.27). Conclusions: Our results indicate reciprocal interactions between OSA and HTN with ACE I/D polymorphism, suggesting that among hypertensive OSA males, the homozygous ACE I allele protects from severe OSA. (C) 2009 Elsevier B.V. All rights reserved.

Insertion/deletion polymorphism of the bradykinin type 2 receptor gene influence diastolic blood pressure

The contribution of kinins to the beneficial effects in cardiovascular risk reductions remains unclear. In this context, the present study examined whether the +9bp/-9 bp polymorphism in bradykinin type 2 receptor gene, predicts hypertension risk in a large urban Brazilian population. Our finding indicated that the -9 bp allele may contribute to hypertension because of increased diastolic pressure.

AP-1 and Egr DNA-binding activities are increased in rat brain during ethanol withdrawal

The DNA-binding activities of AP-1 and Egr proteins were investigated in nuclear extracts of rat brain regions during ethanol withdrawal. Both DNA-binding activities were transiently elevated in the hippocampus and cerebellum 16 h after withdrawal. In the cerebral cortex, AP-1 and Egr DNA-binding activities increased at 16 h and persisted until 32 and 72 h, respectively. The AP-1 DNA-binding activities in all regions at all times after withdrawal were composed of FosB, c-Jun, JunB, and JunD. c-Fos was detected at all times in the cerebral cortex, at 16 h only in the hippocampus, and from 16 to 72 h in the cerebellum. Withdrawal severity did not affect the composition of the AP-1 DNA-binding activities. Two Egr DNA-binding activities were present in the cortex and hippocampus. The faster-migrating complex predominated in hippocampus, and only the slower-migrating complex (identified as Egr-1) was present in the cerebellum. The increase in DNA-binding activity of immediate early gene-encoded transcription factors supports their proposed role in initiating a cascade of altered gene expression underlying the long-term neuronal response to ethanol withdrawal.