Interaction of oligonucleotide-based amphiphilic block copolymers with cell membrane models

Oligonucleotides have unique molecular recognition properties, being involved in biological mechanisms such as cell-surface receptor recognition or gene silencing. For their use in human therapy for drug or gene delivery, the cell membrane remains a barrier, but this can be obviated by grafting a hydrophobic tail to the oligonucleotide. Here we demonstrate that two oligonucleotides, one consisting of 12 guanosine units (G(12)), and the other one consisting of five adenosine and seven guanosine (A(5)G(7)) units, when functionalized with poly(butadiene), namely PB-G(12) and PB-A(5)G(7), can be inserted into Langmuir monolayers of dipalmitoyl phosphatidyl choline (DPPC), which served as a cell membrane model. PB-G(12) and PB-A(5)G(7) were found to affect the DPPC monolayer even at high surface pressures. The effects from PB-G(12) were consistently stronger, particularly in reducing the elasticity of the DPPC monolayers, which may have important biological implications. Multilayers of DPPC and nucleotide-based copolymers could be adsorbed onto solid supports, in the form of Y-type LB films, in which the molecular-level interaction led to lower energies in the vibrational spectra of the nucleotide-based copolymers. This successful deposition of solid films opens the way for devices to be produced which exploit the molecular recognition properties of the nucleotides. (C) 2010 Elsevier Inc. All rights reserved.

Properties of lipophilic nucleoside monolayers at the air-water interface

The capability of self-assembly and molecular recognition of biomolecules is essential for many nanotechnological applications, as in the use of alkyl-modified nucleosides and oligonucleotides to increase the cellular uptake of DNA and RNA. In this study, we show that a lipophilic nucleoside, which is an isomer mixture of 2`-palmitoyluridin und 3`-palmitoyluridin, forms Langmuir monolayers and Langmuir-Blodgett films as a typical amphiphile, though with a smaller elasticity. The nucleoside may be incorporated into dipalmitoyl phosphatidyl choline (DPPC) monolayers that serve as a simplified cell membrane model. The molecular-level interactions between the nucleoside and DPPC led to a remarkable condensation of the mixed monolayer, which affected both surface pressure and surface potential isotherms. The morphology of the mixed monolayers was dominated by the small domains of the nucleoside. The mixed monolayers could be deposited onto solid substrates as a one-layer Langmuir Blodgett film that displayed UV-vis absorption spectra typical of aggregated nucleosides owing to the interaction between the nucleoside and DPPC. The formation of solid films with DNA building blocks in the polar heads may open the way for devices and sensors be produced to exploit their molecular recognition properties. (C) 2010 Elsevier B.V. All rights reserved.

Identification of protein-coding and intronic noncoding RNAs down-regulated in clear cell renal carcinoma

The clear cell subtype of renal cell carcinoma (RCC) is the most lethal and prevalent cancer of the urinary system. To investigate the molecular changes associated with malignant transformation in clear cell RCC, the gene expression profiles of matched samples of tumor and adjacent non-neoplastic tissue were obtained from six patients. A custom-built cDNA microarray platform was used, comprising 2292 probes that map to exons of genes and 822 probes for noncoding RNAs mapping to intronic regions. Intronic transcription was detected in all normal and neoplastic renal tissues. A subset of 55 transcripts was significantly down-regulated in clear cell RCC relative to the matched nontumor tissue as determined by a combination of two statistical tests and leave-one-out patient cross-validation. Among the down-regulated transcripts, 49 mapped to untranslated or coding exons and 6 were intronic relative to known exons of protein-coding genes. Lower levels of expression of SIN3B, TRIP3, SYNJ2BP and NDE1 (P<0.02), and of intronic transcripts derived from SND1 and ACTN4 loci (P<0.05), were confirmed in clear cell RCC by Real-time RT-PCR. A subset of 25 transcripts was deregulated in additional six nonclear cell RCC samples, pointing to common transcriptional alterations in RCC irrespective of the histological subtype or differentiation state of the tumor. Our results indicate a novel set of tumor suppressor gene candidates, including noncoding intronic RNAs, which may play a significant role in malignant transformations of normal renal cells. (C) 2008 Wiley-Liss, Inc.

Interaction of cationic bilayer fragments with a model oligonucleotide

The interaction between cationic bilayer fragments and a model oligonucleotide was investigated by differential scanning calorimetry, turbidimetry, determination of excimer to monomer ratio of 2-(10-(1-pyrene)-decanoyl)-phosphatidyl-choline in bilayer fragment dispersions and dynamic light scattering for sizing and zeta-potential analysis. Salt (Na(2)HPO(4)), mononucleotide (2`-deoxyadenosine-5`-monophosphate) or poly (dA) oligonucleotide (3`-AAA AAA AAA A-5`) affected structure and stability of dioctadecyldimethylammonium bromide bilayer fragments. Oligonucleotide and salt increased bilayer packing due to bilayer fragment fusion. Mononucleotide did not reduce colloid stability or did not cause bilayer fragment fusion. Charge neutralization of bilayer fragments by poly (dA) at 1:10 poly (dA):dioctadecyldimethylammonium bromide molar ratio caused extensive aggregation, maximal size and zero of zeta-potential for the assemblies. Above charge neutralization, assemblies recovered colloid stability due to charge overcompensation. For bilayer fragments/poly (dA), the nonmonotonic behavior of colloid stability as a function of poly (dA) concentration was unique for the oligonucleotide and was not observed for Na(2)HPO(4) or 2`-deoxyadenosine-5`-monophosphate. For the first time, such interactions between cationic bilayer fragments and mono- or oligonucleotide were described in the literature. Bilayer fragments/oligonucleotide assemblies may find interesting applications in drug delivery. (c) 2010 Elsevier B.V. All rights reserved.

Conserved tissue expression signatures of intronic noncoding RNAs transcribed from human and mouse loci

It has been postulated that noncoding RNAs (ncRNAs) are involved in the posttranscriptional control of gene expression, and may have contributed to the emergence of the complex attributes observed in mammalians. We show here that the complement of ncRNAs expressed from intronic regions of the human and mouse genomes comprises at least 78,147 and 39,660 transcriptional units, respectively. To identify conserved intronic sequences expressed in both humans and mice, we used custom-designed human cDNA microarrays to separately interrogate RNA from mouse and human liver, kidney, and prostate tissues. An overlapping tissue expression signature was detected for both species, comprising 198 transcripts; among these, 22 RNAs map to intronic regions with evidence of evolutionary conservation in humans and mice. Transcription of selected human-mouse intronic ncRNAs was confirmed using strand-specific RT-PCR. Altogether, these results support an evolutionarily conserved role of intronic ncRNAs in human and mouse, which are likely to be involved in the fine tuning of gene expression regulation in different mammalian tissues. (C) 2008 Elsevier Inc. All rights reserved.

Caracterização funcional de dois cDNAs homólogos à ciclofilina e à proteína reprimida por auxina (ARP) identificados em bibliotecas subtrativas a para floração em tomateiro

Flowering is a fundamental process in the life cycle for plant. This process is marked by vegetative to reproductive apical meristem conversion, due to interactions between several factors, both internal and external to plant. Therefore, eight subtractive libraries were constructed using apical meristem induced or not induced for two contrasting species: Solanum lycopersicum cv. Micro-Tom and Solanum pimpinellifolium. Several cDNAs were identified and among these, were selected two cDNAs: one homologous cDNA to cyclophilin (LeCYP1) and the other to Auxin repressed protein (ARP). It has observed that LeCYP1 and ARP genes are important in the developmental process to plants. In silico analysis, were used several databases with the exclusion criterion E-value <1.0x10-15. As a result, conservation was observed for proteins analyzed by means of multiple alignments and the presence of functional domains. Then, overexpression cassettes were constructed for the ARP cDNA in sense and antisense orientations. For this step, it was used the CaMV35S promoter. The cDNA orientation (sense or antisense) in relation to the promoter was determined by restriction enzymes and sequencing. Then, this cassette was transferred to binary vector pZP211 and these cassettes were transferred into Agrobacterium tumefaciens LBA4404. S. lycopersicum cv. Micro-Tom (MT) and MT-Rg1 plants were transformed. In addition, seedlings were subjected to hormone treatments using a synthetic auxin (- naphthalene acetic acid) and cyclosporin A (cyclophilin inhibitor) treatments and it was found that the hormone treatment there were changes in development of lateral roots pattern, probably related to decreases in auxin signaling caused by reduction of LeCYP1 in MT-dgt plants while cyclosporin A treatments, there was a slight delay in flowering in cv. MT plants. Furthermore, assay with real-time PCR (RT-qPCR) were done for expression level analysis from LeCYP1 and ARP in order to functionally characterize these sequences in tomato plants.

Caracterização funcional de dois cDNAs de cana-de- açúcar : PKCI e SHAGGY

Flowering is controlled by several environmental and endogenous factors, usually associated with a complex network of metabolic mechanisms. The gene characterization in Arabidopsis model has provided much information about the genetic and molecular mechanisms that control flowering process. Some of these genes had been found in rice and maize. However, in sugarcane this processe is not well known. It is known that early flowering may reduce its production up to 60% at northeast conditions. Considering the impact of early flowering in sugarcane production, the aim of this work was to make the gene characterization of two cDNAs previously identified in subtractive cDNA libraries: scPKCI and scSHAGGY. The in silico analysis showed that these two cDNAs presented both their sequence and functional catalytic domains conserved. The results of transgenic plants containing the overexpression of the gene cassette scPKCI in sense orientation showed that this construction had a negative influence on the plant development as it was observed a decrease in plant height and leaf size. For the scPKCI overexpression in antisense orientation it was observed change in the number of branches from T1 transgenic plants, whereas transgenic T2 plants showed slow development during germination and initial stages of development. The other cDNA analyzed had homology to SHAGGY protein. The overexpression construct in sense orientation did not shown any effect on development. The only difference observed it was an increase in stigma structure. These results allowed us to propose a model how these two genes may be interact and affect floweringdevelopment.

Análise de cDNAs identificados em bibliotecas substrativas de cDNA para floração de variedades de cana-de-açúcar cultivadas no Rio Grande do Norte(RN): fator de transição NAC, Calmodulina e Fosfatidiltransferase

The flowering is a physiological process that it is vital for plants. This physiological process has been well studied in the plant model Arabidopsis, but in sugarcane this process is not well known. The transition of the shoot apical meristem from vegetative to flowering is a critical factor for plant development. At Brazil northeastern region, the transition to flowering in sugarcane has an important effect as it may reduce up to 60% its production. This is a consequence of the sugar translocation from stalks to the shoot apical meristem which is necessary during the flowering process. Therefore, the aim of this work was to explore and analyze cDNAs previously identified using subtractive cDNA libraries. The results showed that these cDNAs showed differential expression profile in varieties of sugarcane (early x late flowering). The in silico analysis suggested that these cDNAs had homology to calmodulin, NAC transcription factor and phosphatidylinositol, a SEC14, which were described in the literature as having a role in the process of floral development. To better understand the role of the cDNA homologous to calmodulin, tobacco plants were transformed with overexpression cassettes in sense and antissense orientation. Plants overexpressing the cassette in sense orientation did not flowered, while plants overexpressing the cassette in the antissense orientation produced flowers. The data obtained in this study suggested the possible role from CAM sequence, SEC14 and NAC in the induction/floral development pathway in sugarcane, this is the first study in order to analyze these genes in the sugarcane flowering process.

Caracterização molecular de isolados de Flavobacterium columnare de tilapia do nilo e piracanjuba por meio de RAPD-PCR

Flavobacterium columnare is a cosmopolite bacteria and it is one of the main problem in Brazilian aquaculture, causing high mortalities index and economic damage. The main factors that contribute to columnaris disease are inadequate water quality, excess handling, high density of fish and temperature variations. For a successful epidemiological study and disease control, it is essential to differentiate the F. columnare from other yellow pigmentation bacteria. The present study used molecular techniques to characterize, by RAPD-PCR, two strains of F. columnare isolated from Oreochromis niloticus and Brycon orbignyanus. Data were analyzed as binary (0 and 1) and a genetic similarity matrix was generated by Jaccard's coefficient. Cluster analysis was performed by the neighbor joining method. The RAPD-PCR technique confirmed to be a usefull tool to obtain genetic profiles from F. columnare isolates based on the oligonucleotides used and to verify genetic similarity.

Infectious bronchitis virus: detection and vaccine Strain differentiation by semi-nested RT-PCR

A semi-nested reverse transcription-polymerase chain reaction (Semi-N-RT-PCR) was developed and used to detect the S glycoprotein gene of infectious bronchitis virus (IBV) strains and to discriminate H120 vaccine strain from other strains. Viral RNA was extracted from the allantoic fluid of chicken embryos and from tissues of chickens experimentally infected with different strains of IBV. Amplification and identification of the viral RNA was performed using two sets of primers complementary to a region of the S glycoprotein gene in the Semi-N-RT-PCR assay. The pair of primers used in the first PCR consisted of universal oligonucleotides flanking a more variable region of S1-S2 gene. The second primer pair was used in the Semi-N-RT-PCR and was comprised of one of the primers from the first universal pair together with either another universal internal oligolucleotide or a oligonucleotide sequence specific for the H120 strain of IBV. The universal primers detected all reference IBV strains and field isolates tested herein. The Semi-N-RT-PCR had high sensitivity and specificity, and was able to differentiate the H120 vaccine strain from other reference IBV strains; including M41 strain. All tissue samples collected from chickens experimentally infected with H120 or M41 strains were positive in the semi-nested RT-PCR using universal primers, while only the H120-infected tissue samples were amplified by the set of primers containing the H120-oligonucleotide. In conclusion, the ability of Semi-N-RT-PCR to detect distinct IBV strains and preliminarily discriminate the vaccine strain (H120) closes a diagnostic gap and offers the opportunity to use comprehensive PCR procedures for the IBV diagnosis.

Identificação e caracterização de um isolado de Hydrangea ringspot virus em hortênsia no Estado de São Paulo

Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)

Padronização da metodologia do RT-PCR utilizado para identificação do mRNA da alfa-amilase em sementes de milho

Durante a germinação das sementes, os carboidratos de reserva são degradados pela atividade de a-amilase. A identificação de mRNA é uma ferramenta fundamental para a definição da cinética de síntese de alfa-amilase. Objetivou-se padronizar a metodologia do RT-PCR para identificar o mRNA do gene de a-amilase em sementes de milho. Após três dias de germinação das cultivares Saracura-BRS 4154 e CATI-AL34, extraiu-se o RNA total pelo método do tiocianato de guanidina-fenol-clorofórmio, com algumas modificações. A partir do RNA total extraído foi obtido cDNA com utilização de random primers. A amplificação por PCR de uma porção do gene da alfa-amilase foi realizada com os primers: sense - CGACATCGACCACCTCAAC; antisense - TTGACCAGCTCCTGCCTGTC; gelatina; DMSO e 1,25 unidades de Taq DNA polimerase por reação e completados com água tratada com DEPC. Os ciclos para a amplificação foram 94ºC durante 4 minutos, seguidos por 34 ciclos de 94ºC durante 1 minuto, 42ºC durante 1 minuto e 72ºC durante 1,5 minutos e, finalmente, 72ºC por 5 minutos. O produto do RT-PCR apresentou uma banda de 249 pares de base (pb) bem definida, para as duas cultivares estudadas, não ocorrendo bandas inespecíficas. A técnica do RT-PCR mostrou ser uma metodologia eficiente para a identificação da expressão de alfa-amilase durante a germinação das sementes e pode ser usado para estudo qualitativo e quantitativo da cinética de síntese dessa enzima em experimentos de germinação.

Amplificação gênica alelo-específica na caracterização das hemoglobinas S, C e D e as interações entre elas e talassemias beta

INTRODUÇÃO: As hemoglobinopatias resultam de alterações hereditárias, sendo prevalentes em muitas regiões do mundo, mas atingem a população brasileira de forma significativa. Elas são decorrentes de alterações em genes estruturais responsáveis pelo aparecimento das hemoglobinas variantes e/ou em genes reguladores, resultando nas talassemias. A identificação dessas patologias tem sido rotineiramente realizada por procedimentos eletroforéticos, contudo nossa experiência laboratorial evidencia que as mesmas nem sempre apresentam resoluções suficientes para a correta caracterização da mutação. CASUÍSTICAS E MÉTODOS: O propósito deste trabalho foi estabelecer uma metodologia válida para a caracterização das hemoglobinas S, C e D em homozigose ou heterozigose, e suas possíveis interações, baseada na amplificação gênica alelo-específica (PCR-AE) com a utilização de primers sense, antisense e primers que se acoplam na posição do alelo mutante e na respectiva posição do alelo normal. RESULTADOS E DISCUSSÃO: Os resultados evidenciaram a validade dessa metodologia na caracterização das mutações, sendo esse procedimento de fácil realização, reprodutível e possível de ser aplicado em um significativo número de amostras.

Caracterização de dois cDNAs homológos e uma AP endonuclease em cana-de-açúcar

The genome of all organisms is subject to injuries that can be caused by endogenous and environmental factors. If these lesions are not corrected, it can be fixed generating a mutation which can be lethal to the organisms. In order to prevent this, there are different DNA repair mechanisms. These mechanisms are well known in bacteria, yeast, human, but not in plants. Two plant models Oriza sativa and Arabidopsis thaliana had the genome sequenced and due to this some DNA repair genes have been characterized. The aim of this work is to characterized two sugarcane cDNAs that had homology to AP endonuclease: scARP1 and scARP3. In silico has been done with these two sequences and other from plants. It has been observed domain conservation on these sequences, but the cystein at 65 position that is a characteristic from the redox domain in APE1 protein was not so conservated in plants. Phylogenetic relationship showed two branches, one branch with dicots and monocots sequence and the other branch with only monocots sequences. Another approach in order to characterized these two cDNAs was to construct overexpression cassettes (sense and antisense orientation) using the 35S promoter. After that, these cassettes were transferred to the binary vector pPZP211. Furthermore, previously in the laboratory was obtained a plant from nicotiana tabacum containing the overexpression cassette in anti-sense orientation. It has been observed that this plant had a slow development and problems in setting seeds. After some manual crossing, some seeds were obtained (T2) and it was analyzed the T2 segregation. The third approach used in this work was to clone the promoter region from these two cDNAs by PCR walking. The sequences obtained were analyzed using the program PLANTCARE. It was observed in these sequences some motives that may be related to oxidative stress response

Targeted Nucleotide Exchange in Bovine Myostatin Gene

Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)