“Constructive Paranoia” Applied to Education (The Case of English Language Teaching)

This paper analyzes the concept of constructive paranoia stated by journalist and author Andrés Oppenheimer to promote development in Latin America. Based on that concept, this paper discusses the effectiveness of current English Language Teaching, particularly, as well as what should be done in order to obtain better results. As a conclusion, a re-structure of approach, curriculum and methodology in teaching the language is proposed.

Language, action, and sensoriality: a multimodal analysis of interactions in inclusive sport climbing with visually impaired athletes

In sport climbing, athletes with vision impairments are constantly accompanied by their guides – usually trainers – both during the preparatory inspection of the routes and whilst climbing. Trainers are, so to speak, the climbers’ eyes, in the sense that they systematically put their vision in the service of the climbers’ mobility and sporting performance. The synergy between trainers and athletes is based on peculiar, strictly multimodal interactive practices that are focused on the body and on its constantly evolving sensory engagement with the materiality of routes. In this context, sensory perception and embodied actions required to plan and execute the climb are configured as genuinely interactive accomplishments. Drawing on the theoretical framework of Embodied and Situated Cognition and on the methodology of Conversation Analysis, this thesis engages in the multimodal analysis of trainer-athlete interactions in paraclimbing. The analysis is based on a corpus of video recorded climbing sessions. The major findings of the study can be summarized as follows. 1) Intercorporeality is key to interactions between trainers and athletes with visual impairments. The participants orient to perceiving the climbing space and acting in it as a ‘We’. 2) The grammar, lexicon, prosody, and timing of the trainers’ instructions are finely tuned to the ongoing corporeal experience of the climbers. 3) Climbers with visual impairments build their actions by using sensory resources that are provided by their trainers. This result is of particular importance as it shows that resources and constraints for action are in a fundamental way constituted in interaction with Others and with specific socio-material ecologies, rather than being defined a priori by the organs and functions of individuals’ body and mind. Individual capabilities are thus enhanced and extended in interaction, which encourages a more ecological view of (dis)ability.

Towards Unstructured Knowledge Integration in Natural Language Processing

In the last decades, Artificial Intelligence has witnessed multiple breakthroughs in deep learning. In particular, purely data-driven approaches have opened to a wide variety of successful applications due to the large availability of data. Nonetheless, the integration of prior knowledge is still required to compensate for specific issues like lack of generalization from limited data, fairness, robustness, and biases. In this thesis, we analyze the methodology of integrating knowledge into deep learning models in the field of Natural Language Processing (NLP). We start by remarking on the importance of knowledge integration. We highlight the possible shortcomings of these approaches and investigate the implications of integrating unstructured textual knowledge. We introduce Unstructured Knowledge Integration (UKI) as the process of integrating unstructured knowledge into machine learning models. We discuss UKI in the field of NLP, where knowledge is represented in a natural language format. We identify UKI as a complex process comprised of multiple sub-processes, different knowledge types, and knowledge integration properties to guarantee. We remark on the challenges of integrating unstructured textual knowledge and bridge connections with well-known research areas in NLP. We provide a unified vision of structured knowledge extraction (KE) and UKI by identifying KE as a sub-process of UKI. We investigate some challenging scenarios where structured knowledge is not a feasible prior assumption and formulate each task from the point of view of UKI. We adopt simple yet effective neural architectures and discuss the challenges of such an approach. Finally, we identify KE as a form of symbolic representation. From this perspective, we remark on the need of defining sophisticated UKI processes to verify the validity of knowledge integration. To this end, we foresee frameworks capable of combining symbolic and sub-symbolic representations for learning as a solution.

Graph-based Vision-Language Model for Multi-Modal Retrieval of Fashion Products

Artificial Intelligence is reshaping the field of fashion industry in different ways. E-commerce retailers exploit their data through AI to enhance their search engines, make outfit suggestions and forecast the success of a specific fashion product. However, it is a challenging endeavour as the data they possess is huge, complex and multi-modal. The most common way to search for fashion products online is by matching keywords with phrases in the product's description which are often cluttered, inadequate and differ across collections and sellers. A customer may also browse an online store's taxonomy, although this is time-consuming and doesn't guarantee relevant items. With the advent of Deep Learning architectures, particularly Vision-Language models, ad-hoc solutions have been proposed to model both the product image and description to solve this problems. However, the suggested solutions do not exploit effectively the semantic or syntactic information of these modalities, and the unique qualities and relations of clothing items. In this work of thesis, a novel approach is proposed to address this issues, which aims to model and process images and text descriptions as graphs in order to exploit the relations inside and between each modality and employs specific techniques to extract syntactic and semantic information. The results obtained show promising performances on different tasks when compared to the present state-of-the-art deep learning architectures.

Bio-QA-GNN: Reasoning with Language Models and Knowledge Graphs for Interpretable Biomedical Question Answering

Nowadays the idea of injecting world or domain-specific structured knowledge into pre-trained language models (PLMs) is becoming an increasingly popular approach for solving problems such as biases, hallucinations, huge architectural sizes, and explainability lack—critical for real-world natural language processing applications in sensitive fields like bioinformatics. One recent work that has garnered much attention in Neuro-symbolic AI is QA-GNN, an end-to-end model for multiple-choice open-domain question answering (MCOQA) tasks via interpretable text-graph reasoning. Unlike previous publications, QA-GNN mutually informs PLMs and graph neural networks (GNNs) on top of relevant facts retrieved from knowledge graphs (KGs). However, taking a more holistic view, existing PLM+KG contributions mainly consider commonsense benchmarks and ignore or shallowly analyze performances on biomedical datasets. This thesis start from a propose of a deep investigation of QA-GNN for biomedicine, comparing existing or brand-new PLMs, KGs, edge-aware GNNs, preprocessing techniques, and initialization strategies. By combining the insights emerged in DISI's research, we introduce Bio-QA-GNN that include a KG. Working with this part has led to an improvement in state-of-the-art of MCOQA model on biomedical/clinical text, largely outperforming the original one (+3.63\% accuracy on MedQA). Our findings also contribute to a better understanding of the explanation degree allowed by joint text-graph reasoning architectures and their effectiveness on different medical subjects and reasoning types. Codes, models, datasets, and demos to reproduce the results are freely available at: \url{https://github.com/disi-unibo-nlp/bio-qagnn}.

Cluster Analysis To Identify Elderly People's Profiles: A Healthcare Strategy Based On Frailty Characteristics.

The new social panorama resulting from aging of the Brazilian population is leading to significant transformations within healthcare. Through the cluster analysis strategy, it was sought to describe the specific care demands of the elderly population, using frailty components. Cross-sectional study based on reviewing medical records, conducted in the geriatric outpatient clinic, Hospital de Clínicas, Universidade Estadual de Campinas (Unicamp). Ninety-eight elderly users of this clinic were evaluated using cluster analysis and instruments for assessing their overall geriatric status and frailty characteristics. The variables that most strongly influenced the formation of clusters were age, functional capacities, cognitive capacity, presence of comorbidities and number of medications used. Three main groups of elderly people could be identified: one with good cognitive and functional performance but with high prevalence of comorbidities (mean age 77.9 years, cognitive impairment in 28.6% and mean of 7.4 comorbidities); a second with more advanced age, greater cognitive impairment and greater dependence (mean age 88.5 years old, cognitive impairment in 84.6% and mean of 7.1 comorbidities); and a third younger group with poor cognitive performance and greater number of comorbidities but functionally independent (mean age 78.5 years old, cognitive impairment in 89.6% and mean of 7.4 comorbidities). These data characterize the profile of this population and can be used as the basis for developing efficient strategies aimed at diminishing functional dependence, poor self-rated health and impaired quality of life.

Site Specific Spin Dynamics In Bafe2as2: Tuning The Ground State By Orbital Differentiation.

The role of orbital differentiation on the emergence of superconductivity in the Fe-based superconductors remains an open question to the scientific community. In this investigation, we employ a suitable microscopic spin probe technique, namely Electron Spin Resonance (ESR), to investigate this issue on selected chemically substituted BaFe2As2 single crystals. As the spin-density wave (SDW) phase is suppressed, we observe a clear increase of the Fe 3d bands anisotropy along with their localization at the FeAs plane. Such an increase of the planar orbital content is interestingly independent of the chemical substitution responsible for suppressing the SDW phase. As a consequence, the magnetic fluctuations in combination with this particular symmetry of the Fe 3d bands are propitious ingredients for the emergence of superconductivity in this class of materials.

Survival Extrapolation In The Presence Of Cause Specific Hazards.

Health economic evaluations require estimates of expected survival from patients receiving different interventions, often over a lifetime. However, data on the patients of interest are typically only available for a much shorter follow-up time, from randomised trials or cohorts. Previous work showed how to use general population mortality to improve extrapolations of the short-term data, assuming a constant additive or multiplicative effect on the hazards for all-cause mortality for study patients relative to the general population. A more plausible assumption may be a constant effect on the hazard for the specific cause of death targeted by the treatments. To address this problem, we use independent parametric survival models for cause-specific mortality among the general population. Because causes of death are unobserved for the patients of interest, a polyhazard model is used to express their all-cause mortality as a sum of latent cause-specific hazards. Assuming proportional cause-specific hazards between the general and study populations then allows us to extrapolate mortality of the patients of interest to the long term. A Bayesian framework is used to jointly model all sources of data. By simulation, we show that ignoring cause-specific hazards leads to biased estimates of mean survival when the proportion of deaths due to the cause of interest changes through time. The methods are applied to an evaluation of implantable cardioverter defibrillators for the prevention of sudden cardiac death among patients with cardiac arrhythmia. After accounting for cause-specific mortality, substantial differences are seen in estimates of life years gained from implantable cardioverter defibrillators.

Post Hoc Analysis Of The Patricia Randomized Trial Of The Efficacy Of Human Papillomavirus Type 16 (hpv-16)/hpv-18 As04-adjuvanted Vaccine Against Incident And Persistent Infection With Nonvaccine Oncogenic Hpv Types Using An Alternative Multiplex Type-specific Pcr Assay For Hpv Dna.

The efficacy of the human papillomavirus type 16 (HPV-16)/HPV-18 AS04-adjuvanted vaccine against cervical infections with HPV in the Papilloma Trial against Cancer in Young Adults (PATRICIA) was evaluated using a combination of the broad-spectrum L1-based SPF10 PCR-DNA enzyme immunoassay (DEIA)/line probe assay (LiPA25) system with type-specific PCRs for HPV-16 and -18. Broad-spectrum PCR assays may underestimate the presence of HPV genotypes present at relatively low concentrations in multiple infections, due to competition between genotypes. Therefore, samples were retrospectively reanalyzed using a testing algorithm incorporating the SPF10 PCR-DEIA/LiPA25 plus a novel E6-based multiplex type-specific PCR and reverse hybridization assay (MPTS12 RHA), which permits detection of a panel of nine oncogenic HPV genotypes (types 16, 18, 31, 33, 35, 45, 52, 58, and 59). For the vaccine against HPV types 16 and 18, there was no major impact on estimates of vaccine efficacy (VE) for incident or 6-month or 12-month persistent infections when the MPTS12 RHA was included in the testing algorithm versus estimates with the protocol-specified algorithm. However, the alternative testing algorithm showed greater sensitivity than the protocol-specified algorithm for detection of some nonvaccine oncogenic HPV types. More cases were gained in the control group than in the vaccine group, leading to higher point estimates of VE for 6-month and 12-month persistent infections for the nonvaccine oncogenic types included in the MPTS12 RHA assay (types 31, 33, 35, 45, 52, 58, and 59). This post hoc analysis indicates that the per-protocol testing algorithm used in PATRICIA underestimated the VE against some nonvaccine oncogenic HPV types and that the choice of the HPV DNA testing methodology is important for the evaluation of VE in clinical trials. (This study has been registered at ClinicalTrials.gov under registration no. NCT00122681.).

Cerebrovascular disease in newborn infants: report of three cases with clinical follow-up and brain spect imaging

The clinical and neurological findings of three neonates with the diagnosis of cerebrovascular disease are reported. The neuropsychological evaluation disclosed impairment of fine motor function, coordination, language, perception and behavioral disturbances. Brain SPECT imaging revealed perfusional deficits in the three cases.

Resonancias discursivas y cortesía en prácticas de lecto-escritura

In this paper we present a study of reading comprehension based on a contrastive argumentative-discursive approach. We examine the relationship between linguistic materiality and discursive processes, observing the connection between reading in a foreign language, writing production and textual memories in the mother tongue. In addition to an interest in practical language teaching and learning processes (in this case of Spanish and Portuguese), we investigate the question of politeness and the theoretical relationship between subjectivity, language, and textuality. The latter, being understood as the result of discourse regularities, is unique for each and every production, yet is also conditioned by plural discursive memories resulting from contradictory social relationships in a specific historical context (Foucault, 1986; Pêcheux, 1990). In the experiment presented here, we follow some of the procedures of the methodology applied in the European Galatea Project developed for the study of reading strategies in the inter-comprehension between Romance languages (Dabène, 1996). We use the procedure of simulation and the subjective projection of participants as well as the notion of discursive resonance in the analysis. The results, having to do with directness and indirectness in speech and the question of politeness in two typologically close languages, lead to the conclusion that the concept of politeness goes beyond a pragmatic strategy used to avoid conflicts to be approached as a marker of cultural identity constitution. The relevance of discursive awareness and its theoretical and practical consequences are then emphasized.

Tradução & aprendizado de língua estrangeira: o ponto de vista do aluno

This paper reports some exemplary data related to a research project on the role of translation in foreign language teaching-learning. The data were collected through a questionnaire administered to 47 Brazilian ESL learners. Specifically, the points of the analysis are: how the translation process is conceived by the students; why and when the translation is used by the learners in classroom situations; mother tongue/foreign language relationships in this specific context, among other aspects. The findings reveal that translation, when used a mediating resource for foreign language teaching-learning, can promote target language management.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Influence of English language in the number of citations of articles published in Brazilian journals of Ophthalmology

PURPOSE: To determine the association between language and number of citations of ophthalmology articles published in Brazilian journals. METHODS: This study was a systematic review. Original articles were identified by review of documents published at the two Brazilian ophthalmology journals indexed at Science Citation Index Expanded - SCIE [Arquivos Brasileiros de Oftalmologia (ABO) and Revista Brasileira de Oftalmologia (RBO)]. All document types (articles and reviews) listed at SCIE in English (English Group) or in Portuguese (Portuguese Group) from January 1, 2008 to December 31, 2009 were included, except: editorial materials; corrections; letters; and biographical items. The primary outcome was the number of citations through the end of second year after publication date. Subgroup analysis included likelihood of citation (cited at least once versus no citation), journal, and year of publication. RESULTS: The search at the web of science revealed 382 articles [107 (28%) in the English Group and 275 (72%) in the Portuguese Group]. Of those, 297 (77.7%) were published at the ABO and 85 (23.3%) at the RBO. The citation counts were statistically significantly higher (P<0.001) in the English Group (1.51 - SD 1.98 - range 0 to 11) compared with the Portuguese Group (0.57 - SD 1.06 - range 0 to 7). The likelihood citation was statistically significant higher (P<0.001) in the English Group (70/107 - 65.4%) compared with the Portuguese Group (89/275 - 32.7%). There were more articles published in English at the ABO (98/297 - 32.9%) than at the RBO (9/85 - 10.6%) [P<0.001]. There were no significant difference (P=0.967) at the proportion of articles published in English at the years 2008 (48/172 - 27.9%) and 2009 (59/210 - 28.1%). CONCLUSION: The number of citations of articles published in Portuguese at Brazilian ophthalmology journals is lower than the published in English. The results of this study suggest that the editorial boards should strongly encourage the authors to adopt English as the main language in their future articles.

Esportes na natureza e deficiencia visual : uma abordagem pedagogica

Universidade Estadual de Campinas . Faculdade de Educação Física