Site Specific Spin Dynamics In Bafe2as2: Tuning The Ground State By Orbital Differentiation.

The role of orbital differentiation on the emergence of superconductivity in the Fe-based superconductors remains an open question to the scientific community. In this investigation, we employ a suitable microscopic spin probe technique, namely Electron Spin Resonance (ESR), to investigate this issue on selected chemically substituted BaFe2As2 single crystals. As the spin-density wave (SDW) phase is suppressed, we observe a clear increase of the Fe 3d bands anisotropy along with their localization at the FeAs plane. Such an increase of the planar orbital content is interestingly independent of the chemical substitution responsible for suppressing the SDW phase. As a consequence, the magnetic fluctuations in combination with this particular symmetry of the Fe 3d bands are propitious ingredients for the emergence of superconductivity in this class of materials.

Survival Extrapolation In The Presence Of Cause Specific Hazards.

Health economic evaluations require estimates of expected survival from patients receiving different interventions, often over a lifetime. However, data on the patients of interest are typically only available for a much shorter follow-up time, from randomised trials or cohorts. Previous work showed how to use general population mortality to improve extrapolations of the short-term data, assuming a constant additive or multiplicative effect on the hazards for all-cause mortality for study patients relative to the general population. A more plausible assumption may be a constant effect on the hazard for the specific cause of death targeted by the treatments. To address this problem, we use independent parametric survival models for cause-specific mortality among the general population. Because causes of death are unobserved for the patients of interest, a polyhazard model is used to express their all-cause mortality as a sum of latent cause-specific hazards. Assuming proportional cause-specific hazards between the general and study populations then allows us to extrapolate mortality of the patients of interest to the long term. A Bayesian framework is used to jointly model all sources of data. By simulation, we show that ignoring cause-specific hazards leads to biased estimates of mean survival when the proportion of deaths due to the cause of interest changes through time. The methods are applied to an evaluation of implantable cardioverter defibrillators for the prevention of sudden cardiac death among patients with cardiac arrhythmia. After accounting for cause-specific mortality, substantial differences are seen in estimates of life years gained from implantable cardioverter defibrillators.

Post Hoc Analysis Of The Patricia Randomized Trial Of The Efficacy Of Human Papillomavirus Type 16 (hpv-16)/hpv-18 As04-adjuvanted Vaccine Against Incident And Persistent Infection With Nonvaccine Oncogenic Hpv Types Using An Alternative Multiplex Type-specific Pcr Assay For Hpv Dna.

The efficacy of the human papillomavirus type 16 (HPV-16)/HPV-18 AS04-adjuvanted vaccine against cervical infections with HPV in the Papilloma Trial against Cancer in Young Adults (PATRICIA) was evaluated using a combination of the broad-spectrum L1-based SPF10 PCR-DNA enzyme immunoassay (DEIA)/line probe assay (LiPA25) system with type-specific PCRs for HPV-16 and -18. Broad-spectrum PCR assays may underestimate the presence of HPV genotypes present at relatively low concentrations in multiple infections, due to competition between genotypes. Therefore, samples were retrospectively reanalyzed using a testing algorithm incorporating the SPF10 PCR-DEIA/LiPA25 plus a novel E6-based multiplex type-specific PCR and reverse hybridization assay (MPTS12 RHA), which permits detection of a panel of nine oncogenic HPV genotypes (types 16, 18, 31, 33, 35, 45, 52, 58, and 59). For the vaccine against HPV types 16 and 18, there was no major impact on estimates of vaccine efficacy (VE) for incident or 6-month or 12-month persistent infections when the MPTS12 RHA was included in the testing algorithm versus estimates with the protocol-specified algorithm. However, the alternative testing algorithm showed greater sensitivity than the protocol-specified algorithm for detection of some nonvaccine oncogenic HPV types. More cases were gained in the control group than in the vaccine group, leading to higher point estimates of VE for 6-month and 12-month persistent infections for the nonvaccine oncogenic types included in the MPTS12 RHA assay (types 31, 33, 35, 45, 52, 58, and 59). This post hoc analysis indicates that the per-protocol testing algorithm used in PATRICIA underestimated the VE against some nonvaccine oncogenic HPV types and that the choice of the HPV DNA testing methodology is important for the evaluation of VE in clinical trials. (This study has been registered at ClinicalTrials.gov under registration no. NCT00122681.).

Sistematização do dimensionamento técnico e econômico de sistemas fotovoltaicos isolados por meio de programa computacional

One of the main referring subjects to the solar energy is how to compare it economically with other sources of energy, as much alternatives as with conventionals (like the electric grid). The purpose of this work was to develop a software which congregates the technical and economic main data to identify, through methods of microeconomic analysis, the commercial viability in the sizing of photovoltaic systems, besides considering the benefits proceeding from the proper energy generation. Considering the period of useful life of the components of the generation system of photovoltaic electricity, the costs of the energy proceeding from the conventional grid had been identified. For the comparison of the conventional sources, electric grid and diesel generation, three scenes of costs of photovoltaic panels and two for the factor of availability of diesel generation had been used. The results have shown that if the cost of the panels is low and the place of installation is more distant of the electric grid, the photovoltaic system becomes the best option.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Estudo da postura corporal e aspectos nutricionais em escolares do ensino fundamental da rede publica

Universidade Estadual de Campinas. Faculdade de Educação Física

Exercicios fisicos na melhoria da qualidade de vida e da capacidade de trabalho e na prevenção da dor e da fadiga, entre trabalhadores de fabrica

Universidade Estadual de Campinas. Faculdade de Educação Física

Effect of different cleansers on the surface of removable partial denture

Removable partial dentures (RPD) demand specific hygienic cleaning and the combination of brushing with immersion in chemical solutions has been the most recommended method for control of biofilm. However, the effect of the cleansers on metallic components has not been widely investigated. This study evaluated the effect of different cleansers on the surface of RPD. Five disc specimens (12 mm x 3 mm metallic disc centered in a 38 x 18 x 4 mm mould filled with resin) were obtained for each experimental situation: 6 solutions [Periogard (PE), Cepacol (CE), Corega Tabs (CT), Medical Interporous (MI), Polident (PO), 0.05% sodium hypochlorite (NaOCl), and distilled water (DW) control] and 2 Co-Cr alloys [DeguDent (DD) and VeraPDI (VPDI)] were used for each experimental situation. A 180-day immersion was simulated and the measurements of roughness (Ra, µm) of metal and resin were analyzed using 2-way ANOVA and Tukey’s test. The surface changes and tarnishes were examined with a scanning electronic microscopy (SEM). In addition, energy dispersive x-ray spectrometry (EDS) analysis was carried out at representative areas. Visually, NaOCl and MI specimens presented surface tarnishes. The roughness of materials was not affected by the solutions (p>0.05). SEM images showed that NaOCl and MI provided surface changes. EDS analysis revealed the presence of oxygen for specimens in contact with both MI and NaOCl solutions, which might suggest that the two solutions promoted the oxidation of the surfaces, thus leading to spot corrosion. Within the limitations of this study, it may be concluded that the NaOCl and MI may not be suitable for cleaning of RPD.

Effect of repeated disinfections by microwave energy on the physical and mechanical properties of denture base acrylic resins

The present study evaluated the effect of repeated simulated microwave disinfection on physical and mechanical properties of Clássico, Onda-Cryl and QC-20 denture base acrylic resins. Aluminum patterns were included in metallic or plastic flasks with dental stone following the traditional packing method. The powder/liquid mixing ratio was established according to the manufacturer's instructions. After water-bath polymerization at 74ºC for 9 h, boiling water for 20 min or microwave energy at 900 W for 10 min, the specimens were deflasked after flask cooling and finished. Each specimen was immersed in 150 mL of distilled water and underwent 5 disinfection cycles in a microwave oven set at 650 W for 3 min. Non-disinfected and disinfected specimens were subjected to the following tets: Knoop hardness test was performed with 25 g load for 10 s, impact strength test was done using the Charpy system with 40 kpcm, and 3-point bending test (flexural strength) was performed at a crosshead speed of 0.5 mm/min until fracture. Data were analyzed statistically by ANOVA and Tukey's test (α= 0.05%). Repeated simulated microwave disinfections decreased the Knoop hardness of Clássico and Onda-Cryl resins and had no effect on the impact strength of QC-20. The flexural strength was similar for all tested resins.

Infectious endocarditis caused by Nocardia sp.: histological morphology as a guide for the specific diagnosis

Nocardia is a rare opportunistic agent, which may affect immunocompromised individuals causing lung infections and exceptionally infective endocarditis (IE). There are few reports of IE caused by Nocardia sp., usually involving biological prostheses but rarely in natural valves. Its accurate microbiological identification may be hampered by the similarity with Rhodococcus equi and Corynebacterium spp. Here we report a case of native mitral valve IE caused by this agent in which the clinical absence of response to vancomycin and the suggestion of Nocardia sp. by histology pointed to the misdiagnosis of Corynebacterium spp. in blood cultures. The histological morphology can advise on the need for expansion of cultivation time and use of extra microbiological procedures that lead to the differential diagnosis with Corynebacterium spp. and other agents, which is essential to establish timely specific treatment, especially in immunocompromised patients.

Effects of dietary energy and nitrogen supplements on rumen fermentation and protozoa population in buffalo and zebu cattle

The effects were assessed of two energy sources in concentrate (ground grain corn vs. citrus pulp) and two nitrogen sources (soybean meal vs. urea) on rumen metabolism in four buffaloes and four zebu cattle (Nellore) with rumen cannula and fed in a 4 × 4 Latin square design with feeds containing 60% sugar cane. Energy supplements had no effect on the rumen ammonia concentration in cattle, but ground grain corn promoted higher ammonia level than citrus pulp in buffalo. Urea produced higher ammonia level than soybean meal in both animal species. On average, the buffaloes maintained a lower rumen ammonia concentration (11.7 mg/dL) than the cattle (14.5 mg/dL). Buffaloes had lower production of acetic acid than cattle (58.7 vs. 61.6 mol/100 mol) and higher of propionic acid (27.4 vs. 23.6 mol/100 mol). There was no difference in the butyric acid production between the buffaloes (13.6 mol/100 mol) and cattle (14.8 mol/100 mol) and neither in the total volatile fatty acids concentration (82.5 vs. 83.6 mM, respectively). The energy or nitrogen sources had no effect on rumen protozoa count in either animal species. The zebu cattle had higher rumen protozoa population (8.8 × 10(5)/mL) than the buffaloes (6.1 × 10(5)/mL). The rumen protozoa population differed between the animal species, except for Dasytricha and Charonina. The buffaloes had a lower Entodinium population than the cattle (61.0 vs 84.9%, respectively) and a greater percentage of species belonging to the Diplodiniinae subfamily than the cattle (28.6 vs. 1.4%, respectively). In cattle, ground corn is a better energy source than citrus pulp for use by Entodinium and Diplodiniinae. In the buffaloes, the Entodinium are favored by urea and Diplodiniinae species by soybean meal.

Validation of the Deardorff model for estimating energy balance components for a sugarcane crop

The quantification of the available energy in the environment is important because it determines photosynthesis, evapotranspiration and, therefore, the final yield of crops. Instruments for measuring the energy balance are costly and indirect estimation alternatives are desirable. This study assessed the Deardorff's model performance during a cycle of a sugarcane crop in Piracicaba, State of São Paulo, Brazil, in comparison to the aerodynamic method. This mechanistic model simulates the energy fluxes (sensible, latent heat and net radiation) at three levels (atmosphere, canopy and soil) using only air temperature, relative humidity and wind speed measured at a reference level above the canopy, crop leaf area index, and some pre-calibrated parameters (canopy albedo, soil emissivity, atmospheric transmissivity and hydrological characteristics of the soil). The analysis was made for different time scales, insolation conditions and seasons (spring, summer and autumn). Analyzing all data of 15 minute intervals, the model presented good performance for net radiation simulation in different insolations and seasons. The latent heat flux in the atmosphere and the sensible heat flux in the atmosphere did not present differences in comparison to data from the aerodynamic method during the autumn. The sensible heat flux in the soil was poorly simulated by the model due to the poor performance of the soil water balance method. The Deardorff's model improved in general the flux simulations in comparison to the aerodynamic method when more insolation was available in the environment.

Comparison of some theoretical models for fittings of the temperature dependence of the fundamental energy gap in GaAs

In this work we report on a comparison of some theoretical models usually used to fit the dependence on temperature of the fundamental energy gap of semiconductor materials. We used in our investigations the theoretical models of Viña, Pässler-p and Pässler-ρ to fit several sets of experimental data, available in the literature for the energy gap of GaAs in the temperature range from 12 to 974 K. Performing several fittings for different values of the upper limit of the analyzed temperature range (Tmax), we were able to follow in a systematic way the evolution of the fitting parameters up to the limit of high temperatures and make a comparison between the zero-point values obtained from the different models by extrapolating the linear dependence of the gaps at high T to T = 0 K and that determined by the dependence of the gap on isotope mass. Using experimental data measured by absorption spectroscopy, we observed the non-linear behavior of Eg(T) of GaAs for T > ΘD.

High-energy events and short-term changes in superficial beach sediments

Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)

Biotin-avidin sandwich elisa with specific human isotypes IgG1 and IgG4 for Culicidae mosquito blood meal identification from an epizootic yellow fever area in Brazil

With a view toward investigating the feeding behavior of Culicidae mosquitoes from an area of epizootic yellow fever transmission in the municipalities of Garruchos and Santo Antônio das Missões, Rio Grande do Sul State, Brazil, specimens were collected by aspiration from September 2005 to April 2007. The engorged females were submitted to blood meal identification by enzyme-linked immunosorbent assay (ELISA). A total of 142 blood-engorged samples were examined for human or monkey blood through species-specific IgG. Additional tests for specificity utilizing isotypes IgG1 and IgG4 of human monoclonal antibodies showed that only anti-human IgG1 was effective in recognizing blood meals of human origin. The results indicated a significant difference (p = 0.027) in detection patterns in samples of Haemagogus leucocelaenus recorded from human blood meals at Santo Antônio das Missões, which suggests some degree of exposure, since it was an area where epizootic outbreaks have been reported.