Fractalkine (cx3cl1) Is Involved In The Early Activation Of Hypothalamic Inflammation In Experimental Obesity.

Hypothalamic inflammation is a common feature of experimental obesity. Dietary fats are important triggers of this process, inducing the activation of toll-like receptor-4 (TLR4) signaling and endoplasmic reticulum stress. Microglia cells, which are the cellular components of the innate immune system in the brain, are expected to play a role in the early activation of diet-induced hypothalamic inflammation. Here, we use bone marrow transplants to generate mice chimeras that express a functional TLR4 in the entire body except in bone marrow-derived cells or only in bone marrow-derived cells. We show that a functional TLR4 in bone marrow-derived cells is required for the complete expression of the diet-induced obese phenotype and for the perpetuation of inflammation in the hypothalamus. In an obesity-prone mouse strain, the chemokine CX3CL1 (fractalkine) is rapidly induced in the neurons of the hypothalamus after the introduction of a high-fat diet. The inhibition of hypothalamic fractalkine reduces diet-induced hypothalamic inflammation and the recruitment of bone marrow-derived monocytic cells to the hypothalamus; in addition, this inhibition reduces obesity and protects against diet-induced glucose intolerance. Thus, fractalkine is an important player in the early induction of diet-induced hypothalamic inflammation, and its inhibition impairs the induction of the obese and glucose intolerance phenotypes.

[how The Gynecologist Can Guide Women With A Family History Of Cancer?].

36

Facial Changes After Early Treatment Of Unilateral Coronal Synostosis Question The Necessity Of Primary Nasal Osteotomy.

The premature fusion of unilateral coronal suture can cause a significant asymmetry of the craniofacial skeleton, with an oblique deviation of the cranial base that negatively impacts soft tissue facial symmetry. The purpose of this study was to assess facial symmetry obtained in patients with unilateral coronal synostosis (UCS) surgically treated by 2 different techniques. We hypothesized that nasal deviation should not be addressed in a primary surgical correction of UCS. Consecutive UCS patients were enrolled in a prospective study and randomly divided into 2 groups. In group 1, the patients underwent total frontal reconstruction and transferring of onlay bone grafts to the recessive superior orbital rim (n = 7), and in group 2, the patients underwent total frontal reconstruction and unilateral fronto-orbital advancement (n = 5). Computerized photogrammetric analysis measured vertical and horizontal axis of the nose and the orbital globe in the preoperative and postoperative periods. Intragroup and intergroup comparisons were performed. Intragroup preoperative and postoperative comparisons showed a significant (all P < 0.05) reduction of the nasal axis and the orbital-globe axis in the postoperative period in the 2 groups. Intergroup comparisons showed no significant difference (all P > 0.05). Facial symmetry was achieved in the patients with UCS who underwent surgery regardless of surgical approach evaluated here. Our data showed a significant improvement in nasal and orbital-globe deviation, leading us to question the necessity of primary nasal correction in these patients.

Detection Of Explosives On The Surface Of Banknotes By Raman Hyperspectral Imaging And Independent Component Analysis.

The aim of this study was to develop a methodology using Raman hyperspectral imaging and chemometric methods for identification of pre- and post-blast explosive residues on banknote surfaces. The explosives studied were of military, commercial and propellant uses. After the acquisition of the hyperspectral imaging, independent component analysis (ICA) was applied to extract the pure spectra and the distribution of the corresponding image constituents. The performance of the methodology was evaluated by the explained variance and the lack of fit of the models, by comparing the ICA recovered spectra with the reference spectra using correlation coefficients and by the presence of rotational ambiguity in the ICA solutions. The methodology was applied to forensic samples to solve an automated teller machine explosion case. Independent component analysis proved to be a suitable method of resolving curves, achieving equivalent performance with the multivariate curve resolution with alternating least squares (MCR-ALS) method. At low concentrations, MCR-ALS presents some limitations, as it did not provide the correct solution. The detection limit of the methodology presented in this study was 50μgcm(-2).

A screening method for detection of hexavalent chromium levels in soils

A rapid and low cost method to determine Cr(VI) in soils based upon alkaline metal extraction at room temperature is proposed as a semi-quantitative procedure to be performed in the field. A color comparison with standards with contents of Cr(VI) in the range of 10 to 150 mg kg-1 was used throughout. For the different types of soils studied, more than 75% of the fortified soluble Cr(VI) were recovered for all levels of spike tested for both the proposed and standard methods. Recoveries of 83 and 99% were obtained for the proposed and the standard methods, respectively, taking into account the analysis of a heavily contaminated soil sample.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Spontaneous puberty in girls with early diagnosis of Turner syndrome

OBJECTIVE: To verify if the frequency of spontaneous pubertal development among girls with Turner syndrome (TS) diagnosed in infancy and childhood is greater than that of patients diagnosed later. SUBJECTS AND METHODS: Thirty three girls aged < 10 years at the time of diagnosis were evaluated regarding pubertal development. The frequency of spontaneous puberty was compared with that of girls aged > 13 years diagnosed at the same service. RESULTS: Sixteen of 32 informative patients had signs of spontaneous puberty, a frequency greater than that of patients diagnosed later. In six patients, there was no progression of puberty; menarche occurred in six, and one became pregnant, but the fetus was a stillborn. Spontaneous puberty was absent in all cases with 45,X karyotype. CONCLUSIONS: The greater prevalence of spontaneous puberty in girls whose diagnosis was not based on pubertal delay suggests that, among those diagnosed later, there is a bias towards patients with hypogonadism. Arq Bras Endocrinol Metab. 2012;56(9):653-7

Early treatment of Class III malocclusion: 10-year clinical follow-up

Angle Class III malocclusion has been a challenge for researchers concerning diagnosis, prognosis and treatment. It has a prevalence of 5% in the Brazilian population, and may have a genetic or environmental etiology. This malocclusion can be classified as dentoalveolar, skeletal or functional, which will determine the prognosis. Considering these topics, the aim of this study was to describe and discuss a clinical case with functional Class III malocclusion treated by a two-stage approach (interceptive and corrective), with a long-term follow-up. In this case, the patient was treated with a chincup and an Eschler arch, used simultaneously during 14 months, followed by corrective orthodontics. It should be noticed that, in this case, initial diagnosis at the centric relation allowed visualizing the anterior teeth in an edge-to-edge relationship, thereby favoring the prognosis. After completion of the treatment, the patient was followed for a 10-year period, and stability was observed. The clinical treatment results showed that it is possible to achieve favorable outcomes with early management in functional Class III malocclusion patients.

Effects of a novel calcium aluminate cement on the early events of the progression of osteogenic cell cultures

The present study evaluated the progression of osteogenic cell cultures exposed to a novel calcium aluminate cement (CAC+) in comparison with the gold standard mineral trioxide aggregate (MTA). Cells were enzimatically isolated from newborn rat calvarial bone, plated on glass coverslips containing either CAC+ or a control MTA samples in the center, and grown under standard osteogenic conditions. Over the 10-day culture period, roundening of sample edges was clearly noticed only for MTA group. Although both cements supported osteogenic cell adhesion, spreading, and proliferation, CAC+-exposed cultures showed significantly higher values in terms of total cell number at days 3 and 7, and total protein content and alkaline phosphatase activity at day 10. The present in vitro results indicate that the exposure to CAC+ supports a higher differentiation of osteogenic cells compared with the ones exposed to MTA. Further experimental studies should consider CAC+ as a potential alternative to MTA when the repair of mineralized tissues is one of the desired outcomes in endodontic therapy.

Detection of human cytomegalovirus and Epstein-Barr virus in coronary atherosclerotic tissue

Previous studies indicated that patients with atherosclerosis are predominantly infected by human cytomegalovirus (HCMV), but rarely infected by type 1 Epstein-Barr virus (EBV-1). In this study, atheromas of 30 patients who underwent aortocoronary bypass surgery with coronary endartherectomy were tested for the presence of these two viruses. HCMV occurred in 93.3% of the samples and EBV-1 was present in 50% of them. Concurrent presence of both pathogens was detected in 43.3% of the samples.

Validity and reliability of methods for the detection of secondary caries around amalgam restorations in primary teeth

Secondary caries has been reported as the main reason for restoration replacement. The aim of this in vitro study was to evaluate the performance of different methods - visual inspection, laser fluorescence (DIAGNOdent), radiography and tactile examination - for secondary caries detection in primary molars restored with amalgam. Fifty-four primary molars were photographed and 73 suspect sites adjacent to amalgam restorations were selected. Two examiners evaluated independently these sites using all methods. Agreement between examiners was assessed by the Kappa test. To validate the methods, a caries-detector dye was used after restoration removal. The best cut-off points for the sample were found by a Receiver Operator Characteristic (ROC) analysis, and the area under the ROC curve (Az), and the sensitivity, specificity and accuracy of the methods were calculated for enamel (D2) and dentine (D3) thresholds. These parameters were found for each method and then compared by the McNemar test. The tactile examination and visual inspection presented the highest inter-examiner agreement for the D2 and D3 thresholds, respectively. The visual inspection also showed better performance than the other methods for both thresholds (Az = 0.861 and Az = 0.841, respectively). In conclusion, the visual inspection presented the best performance for detecting enamel and dentin secondary caries in primary teeth restored with amalgam.

Detection of Brucella ovis in ovine from Paraíba State, in the Northeast region of Brazil

To determine the presence of Brucella ovis in ovine from Paraíba State, in the Northeast region of Brazil, 80 animals slaughtered in the public slaughterhouse of Patos city were used. Before slaughter, blood samples were collected by jugular venopuncture from each animal, and after slaughter, testicles, epidydimus and uterus were aseptically collected. For the serological diagnosis of B. ovis and B. abortus infections, the agar gel immunodiffusion (AGID) and Rose Bengal (RBT) tests were carried out, respectively. In addition, microbiological culture and polymerase chain reaction (PCR) were performed on testicle, epidydimus and uterus samples. Six animals (7.5%) tested positive for the presence of B. ovis antibodies and all animals tested negative for the presence of B. abortus antibodies. One AGID-positive animal tested positive at uterine swab culture. PCR was able to amplify DNA of Brucella spp. from the pool of testicle, epidydimus and uterus samples from AGID-positive animals. This is the first report of isolation and detection of B. ovis DNA by PCR in ovine from the Northeast region of Brazil.

Perspectivas da investigação sobre determinantes sociais em câncer

As diferenças socioeconômicas têm reflexos no perfil epidemiológico de câncer, no que diz respeito a incidência, mortalidade, sobrevida e qualidade de vida após o diagnóstico. Neste artigo examinam-se as disparidades da ocorrência de câncer na população brasileira e sintetizam-se evidências das investigações sobre determinantes sociais em câncer. Foram considerados os principais fatores que modulam a influência das condições socioeconômicas na ocorrência do câncer, como tabagismo, consumo de álcool, hábitos alimentares e obesidade, ocupação e acesso aos serviços de saúde. Modificações nas condições sociais dependem de mudanças estruturais na sociedade, a exemplo de melhorias do nível educacional; no entanto, investigações epidemiológicas bem conduzidas podem contribuir para o planejamento de intervenções visando a reduzir o impacto dos determinantes sociais em câncer. Esses estudos devem prover estratégias para promoção da qualidade das informações de incidência e mortalidade; realização periódica de inquéritos populacionais sobre prevalência de fatores de risco para câncer; desenvolver desenhos epidemiológicos mais eficientes para avaliar o efeito de fatores etiológicos em câncer e suas relações com o status social; análise de programas de rastreamento para tumores passíveis de detecção precoce; e avaliações do acesso da população ao diagnóstico e tratamento. Essas pesquisas devem contemplar populações em distintas regiões do mundo, em particular aquelas vivendo em regiões marginalizadas da dinâmica do atual sistema econômico global.

Fatores associados a não realização da mamografia e do exame clínico das mamas: um estudo de base populacional em Campinas, São Paulo, Brasil

O objetivo deste estudo é analisar a prevalência da não realização do exame clínico das mamas e da mamografia segundo variáveis sócio-econômicas, demográficas e de comportamentos relacionados à saúde, em mulheres com 40 anos ou mais, residentes na cidade de Campinas, São Paulo, Brasil. O estudo foi do tipo transversal, de base populacional em uma amostra de 290 mulheres. Os fatores associados à não realização da mamografia, encontrados na análise multivariada, foram: ter 70 anos ou mais, ser de raça/cor negra e pertencer ao segmento de menor renda familiar per capita; e para a não realização do exame clínico das mamas foram: não ter companheiro e pertencer ao segmento de menor renda familiar per capita. O SUS foi responsável pela realização de 28,8% das mamografias e 38,2% dos exames clínicos das mamas. Verificou-se que a não realização dos exames preventivos para o câncer de mama está associada à existência de desigualdade racial e social, apontando para a necessidade de implementação de estratégias para a ampliação da cobertura das práticas preventivas para o câncer de mama, especialmente para os segmentos sociais mais vulneráveis.

Evaluation of a recombinant p24 antigen for the detection of Feline Immunodeficiency Virus-specific antibodies

Feline Immunodeficiency Virus is a worldwide infection and is considered a significant pathogen. The diagnosis of FIV infections is mainly based on commercially available rapid tests that are highly expensive in Brazil, hence it is rarely performed in the country. Furthermore, lentiviruses grow slowly and poorly in tissue cultures, making the production of viral antigen by classic means and thus the establishment of FIV immunodiagnosis impracticable. In order to deal with this, recombinant DNA techniques were adopted to produce the protein p24, a viral capsid antigen. The protein's reactivity evaluation analyzed by Western blot indicated that this recombinant antigen can be a useful tool for the immunodiagnostic of FIV infections.