Vibration based health monitoring of civil infrastructure using energy harvesting techniques

The use of structural health monitoring of civil structures is ever expanding and by assessing the dynamical condition of structures, informed maintenance management can be conducted at both individual and network levels. With the continued growth of information age technology, the potential arises for smart monitoring systems to be integrated with civil infrastructure to provide efficient information on the condition of a structure. The focus of this thesis is the integration of smart technology with civil infrastructure for the purposes of structural health monitoring. The technology considered in this regard are devices based on energy harvesting materials. While there has been considerable focus on the development and optimisation of such devices using steady state loading conditions, their applications for civil infrastructure are less known. Although research is still in initial stages, studies into the uses associated with such applications are very promising. Through the use of the dynamical response of structures to a variety of loading conditions, the energy harvesting outputs from such devices is established and the potential power output determined. Through a power variance output approach, damage detection of deteriorating structures using the energy harvesting devices is investigated. Further applications of the integration of energy harvesting devices with civil infrastructure investigated by this research includes the use of the power output as a indicator for control. Four approaches are undertaken to determine the potential applications arising from integrating smart technology with civil infrastructure, namely • Theoretical analysis to determine the applications of energy harvesting devices for vibration based health monitoring of civil infrastructure. • Laboratory experimentation to verify the performance of different energy harvesting configurations for civil infrastructure applications. • Scaled model testing as a method to experimentally validate the integration of the energy harvesting devices with civil infrastructure. • Full scale deployment of energy harvesting device with a bridge structure. These four approaches validate the application of energy harvesting technology with civil infrastructure from a theoretical, experimental and practical perspective.

Fiber-optic vibration sensing of cantilevers immersed in fluids

An all fiber-optical method to monitor densities and viscosities of liquids utilizing a steel cantilever (4 x 0.3 x 0.08 cm3) is presented. The actuation is performed by photothermally heating the cantilever at its base with an intensity-modulated 808 nm diode laser. The cantilever vibrations are picked up by an in-fiber Fabry Perot cavity sensor attached along the length of the cantilever. The fluid properties can be related to the resonance characteristics of the cantilever, e.g. a shift in the resonance frequency corresponds to a change in fluid density, and the width of the resonance peak gives information on the dynamic viscosity after calibration of the system. Aqueous glycerol, sucrose and ethanol samples in the range of 0.79–1.32 gcm−3 (density) and 0.89–702 mPas (viscosity) were used to investigate the limits of the sensor. A good agreement with literature values could be found with an average deviation of around 10 % for the dynamic viscosities, and 5–16 % for the mass densities. A variety of clear and opaque commercial spirits and an unknown viscous sample, e.g. home-made maple syrup, were analyzed and compared to literature values. The unique detection mechanism allows for the characterization of opaque samples and is superior to conventional microcantilever sensors. The method is expected to be beneficial in various industrial sectors such as quality control of food samples.

A field experiment on a steel Gerber-truss bridge for damage detection utilizing vehicle-induced vibrations

A field experiment was conducted on a real continuous steel Gerber-truss bridge with artificial damage applied. This article summarizes the results of the experiment for bridge damage detection utilizing traffic-induced vibrations. It investigates the sensitivities of a number of quantities to bridge damage including the identified modal parameters and their statistical patterns, Nair’s damage indicator and its statistical pattern and different sets of measurement points. The modal parameters are identified by autoregressive time-series models. The decision on bridge health condition is made and the sensitivity of variables is evaluated with the aid of the Mahalanobis–Taguchi system, a multivariate pattern recognition tool. Several observations are made as follows. For the modal parameters, although bridge damage detection can be achieved by performing Mahalanobis–Taguchi system on certain modal parameters of certain sets of measurement points, difficulties were faced in subjective selection of meaningful bridge modes and low sensitivity of the statistical pattern of the modal parameters to damage. For Nair’s damage indicator, bridge damage detection could be achieved by performing Mahalanobis–Taguchi system on Nair’s damage indicators of most sets of measurement points. As a damage indicator, Nair’s damage indicator was superior to the modal parameters. Three main advantages were observed: it does not require any subjective decision in calculating Nair’s damage indicator, thus potential human errors can be prevented and an automatic detection task can be achieved; its statistical pattern has high sensitivity to damage and, finally, it is flexible regarding the choice of sets of measurement points.

Damage Identification of Structures through Vibration-Based Structural Monitoring Systems

The thesis has been carried out within the “SHAPE Project - Predicting Strength Changes in Bridges from Frequency Data Safety, Hazard, and Poly-harmonic Evaluation” (ERA-NET Plus Infravation Call 2014) which dealt with the structural assessment of existing bridges and laboratory structural reproductions through the use of vibration-based monitoring systems, for detecting changes in their natural frequencies and correlating them with the occurrence of damage. The main purpose of this PhD dissertation has been the detection of the variation of the main natural frequencies as a consequence of a previous-established damage configuration provided on a structure. Firstly, the effect of local damage on the modal feature has been discussed mainly concerning a steel frame and a composite steel-concrete bridge. Concerning the variation of the fundamental frequency of the small bridge, the increasing severity of two local damages has been investigated. Moreover, the comparison with a 3D FE model is even presented establishing a link between the dynamic properties and the damage features. Then, moving towards a diffused damage pattern, four concrete beams and a small concrete deck were loaded achieving the yielding of the steel reinforcement. The stiffness deterioration in terms of frequency shifts has been reconsidered by collecting a large set of dynamic experiments on simply supported R.C. beams discussed in the literature. The comparison of the load-frequency curves suggested a significant agreement among all the experiments. Thus, in the framework of damage mechanics, the “breathing cracks” phenomenon has been discussed leading to an analytical formula able to explain the frequency decay observed experimentally. Lastly, some dynamic investigations of two existing bridges and the corresponding FE Models are presented in Chapter 4. Moreover, concerning the bridge in Bologna, two prototypes of a network of accelerometers were installed and the data of a few months of monitoring have been discussed.

The Lea Grating Test In Assessing Detection Grating Acuity In Normal Infants Less Than 4 Months Of Age.

To assess binocular detection grating acuity using the LEA GRATINGS test to establish age-related norms in healthy infants during their first 3 months of life. In this prospective, longitudinal study of healthy infants with clear red reflex at birth, responses to gratings were measured at 1, 2, and 3 months of age using LEA gratings at a distance of 28 cm. The results were recorded as detection grating acuity values, which were arranged in frequency tables and converted to a one-octave scale for statistical analysis. For the repeated measurements, analysis of variance (ANOVA) was used to compare the detection grating acuity results between ages. A total of 133 infants were included. The binocular responses to gratings showed development toward higher mean values and spatial frequencies, ranging from 0.55 ± 0.70 cycles per degree (cpd), or 1.74 ± 0.21 logMAR, in month 1 to 3.11 ± 0.54 cpd, or 0.98 ± 0.16 logMAR, in month 3. Repeated ANOVA indicated differences among grating acuity values in the three age groups. The LEA GRATINGS test allowed assessment of detection grating acuity and its development in a cohort of healthy infants during their first 3 months of life.

Determination Of Tetrakis(hydroxymethyl)phosphonium Sulfate In Commercial Formulations And Cooling Water By Capillary Electrophoresis With Contactless Conductivity Detection.

A novel capillary electrophoresis method using capacitively coupled contactless conductivity detection is proposed for the determination of the biocide tetrakis(hydroxymethyl)phosphonium sulfate. The feasibility of the electrophoretic separation of this biocide was attributed to the formation of an anionic complex between the biocide and borate ions in the background electrolyte. Evidence of this complex formation was provided by (11) B NMR spectroscopy. A linear relationship (R(2) = 0.9990) between the peak area of the complex and the biocide concentration (50-900 μmol/L) was found. The limit of detection and limit of quantification were 15.0 and 50.1 μmol/L, respectively. The proposed method was applied to the determination of tetrakis(hydroxymethyl)phosphonium sulfate in commercial formulations, and the results were in good agreement with those obtained by the standard iodometric titration method. The method was also evaluated for the analysis of tap water and cooling water samples treated with the biocide. The results of the recovery tests at three concentration levels (300, 400, and 600 μmol/L) varied from 75 to 99%, with a relative standard deviation no higher than 9%.

Human Herpesvirus Infections Of The Central Nervous System: Laboratory Diagnosis Based On Dna Detection By Nested Pcr In Plasma And Cerebrospinal Fluid Samples.

Infections of the central nervous systems (CNS) present a diagnostic problem for which an accurate laboratory diagnosis is essential. Invasive practices, such as cerebral biopsy, have been replaced by obtaining a polymerase chain reaction (PCR) diagnosis using cerebral spinal fluid (CSF) as a reference method. Tests on DNA extracted from plasma are noninvasive, thus avoiding all of the collateral effects and patient risks associated with CSF collection. This study aimed to determine whether plasma can replace CSF in nested PCR analysis for the detection of CNS human herpesvirus (HHV) diseases by analysing the proportion of patients whose CSF nested PCR results were positive for CNS HHV who also had the same organism identified by plasma nested PCR. In this study, CSF DNA was used as the gold standard, and nested PCR was performed on both types of samples. Fifty-two patients with symptoms of nervous system infection were submitted to CSF and blood collection. For the eight HHV, one positive DNA result-in plasma and/or CSF nested PCR-was considered an active HHV infection, whereas the occurrence of two or more HHVs in the same sample was considered a coinfection. HHV infections were positively detected in 27/52 (51.9%) of the CSF and in 32/52 (61.5%) of the plasma, difference not significant, thus nested PCR can be performed on plasma instead of CSF. In conclusion, this findings suggest that plasma as a useful material for the diagnosis of cases where there is any difficulty to perform a CSF puncture.

Detection Of Explosives On The Surface Of Banknotes By Raman Hyperspectral Imaging And Independent Component Analysis.

The aim of this study was to develop a methodology using Raman hyperspectral imaging and chemometric methods for identification of pre- and post-blast explosive residues on banknote surfaces. The explosives studied were of military, commercial and propellant uses. After the acquisition of the hyperspectral imaging, independent component analysis (ICA) was applied to extract the pure spectra and the distribution of the corresponding image constituents. The performance of the methodology was evaluated by the explained variance and the lack of fit of the models, by comparing the ICA recovered spectra with the reference spectra using correlation coefficients and by the presence of rotational ambiguity in the ICA solutions. The methodology was applied to forensic samples to solve an automated teller machine explosion case. Independent component analysis proved to be a suitable method of resolving curves, achieving equivalent performance with the multivariate curve resolution with alternating least squares (MCR-ALS) method. At low concentrations, MCR-ALS presents some limitations, as it did not provide the correct solution. The detection limit of the methodology presented in this study was 50μgcm(-2).

A screening method for detection of hexavalent chromium levels in soils

A rapid and low cost method to determine Cr(VI) in soils based upon alkaline metal extraction at room temperature is proposed as a semi-quantitative procedure to be performed in the field. A color comparison with standards with contents of Cr(VI) in the range of 10 to 150 mg kg-1 was used throughout. For the different types of soils studied, more than 75% of the fortified soluble Cr(VI) were recovered for all levels of spike tested for both the proposed and standard methods. Recoveries of 83 and 99% were obtained for the proposed and the standard methods, respectively, taking into account the analysis of a heavily contaminated soil sample.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Analysis of TMJ vibration sounds before and after use of two types of occlusal splints

Temporomandibular joint (TMJ) sounds are important and common physical signs of temporomandibular disorders (TMD). The aim of this study was to evaluate the influence of the effect of the use of occlusal bite splints (stabilizing and repositioning) on the sounds produced in the TMJ, by means of the electrovibratography (EVG). Thirty-one patients with TMD from the Dental School of Ribeirão Preto, University of São Paulo, Brazil were selected for this study. Group 1 (n=23) wore stabilizing bite splints and Group 2 (n=8) used anterior repositioning splints. Before and after treatment with occlusal splints both groups were analyzed using the SonoPAK Q/S recording system (BioResearch System, Inc.). The treatments with stabilizing bite splints were satisfactory, since they reduced the total amount of the sound energies (p<0.05), but the use of anterior repositioning splints for no more than 4 weeks produced significantly better results (p<0.01). The total amount of vibration energy involved in the vibrating movements of the TMJ showed significant improvement using anterior repositioning splints.

Detection of human cytomegalovirus and Epstein-Barr virus in coronary atherosclerotic tissue

Previous studies indicated that patients with atherosclerosis are predominantly infected by human cytomegalovirus (HCMV), but rarely infected by type 1 Epstein-Barr virus (EBV-1). In this study, atheromas of 30 patients who underwent aortocoronary bypass surgery with coronary endartherectomy were tested for the presence of these two viruses. HCMV occurred in 93.3% of the samples and EBV-1 was present in 50% of them. Concurrent presence of both pathogens was detected in 43.3% of the samples.

Validity and reliability of methods for the detection of secondary caries around amalgam restorations in primary teeth

Secondary caries has been reported as the main reason for restoration replacement. The aim of this in vitro study was to evaluate the performance of different methods - visual inspection, laser fluorescence (DIAGNOdent), radiography and tactile examination - for secondary caries detection in primary molars restored with amalgam. Fifty-four primary molars were photographed and 73 suspect sites adjacent to amalgam restorations were selected. Two examiners evaluated independently these sites using all methods. Agreement between examiners was assessed by the Kappa test. To validate the methods, a caries-detector dye was used after restoration removal. The best cut-off points for the sample were found by a Receiver Operator Characteristic (ROC) analysis, and the area under the ROC curve (Az), and the sensitivity, specificity and accuracy of the methods were calculated for enamel (D2) and dentine (D3) thresholds. These parameters were found for each method and then compared by the McNemar test. The tactile examination and visual inspection presented the highest inter-examiner agreement for the D2 and D3 thresholds, respectively. The visual inspection also showed better performance than the other methods for both thresholds (Az = 0.861 and Az = 0.841, respectively). In conclusion, the visual inspection presented the best performance for detecting enamel and dentin secondary caries in primary teeth restored with amalgam.

Spatial pattern detection modeling of thrips (Thrips tabaci) on onion fields

Onion (Allium cepa) is one of the most cultivated and consumed vegetables in Brazil and its importance is due to the large laborforce involved. One of the main pests that affect this crop is the Onion Thrips (Thrips tabaci), but the spatial distribution of this insect, although important, has not been considered in crop management recommendations, experimental planning or sampling procedures. Our purpose here is to consider statistical tools to detect and model spatial patterns of the occurrence of the onion thrips. In order to characterize the spatial distribution pattern of the Onion Thrips a survey was carried out to record the number of insects in each development phase on onion plant leaves, on different dates and sample locations, in four rural properties with neighboring farms under different infestation levels and planting methods. The Mantel randomization test proved to be a useful tool to test for spatial correlation which, when detected, was described by a mixed spatial Poisson model with a geostatistical random component and parameters allowing for a characterization of the spatial pattern, as well as the production of prediction maps of susceptibility to levels of infestation throughout the area.

Detection of Brucella ovis in ovine from Paraíba State, in the Northeast region of Brazil

To determine the presence of Brucella ovis in ovine from Paraíba State, in the Northeast region of Brazil, 80 animals slaughtered in the public slaughterhouse of Patos city were used. Before slaughter, blood samples were collected by jugular venopuncture from each animal, and after slaughter, testicles, epidydimus and uterus were aseptically collected. For the serological diagnosis of B. ovis and B. abortus infections, the agar gel immunodiffusion (AGID) and Rose Bengal (RBT) tests were carried out, respectively. In addition, microbiological culture and polymerase chain reaction (PCR) were performed on testicle, epidydimus and uterus samples. Six animals (7.5%) tested positive for the presence of B. ovis antibodies and all animals tested negative for the presence of B. abortus antibodies. One AGID-positive animal tested positive at uterine swab culture. PCR was able to amplify DNA of Brucella spp. from the pool of testicle, epidydimus and uterus samples from AGID-positive animals. This is the first report of isolation and detection of B. ovis DNA by PCR in ovine from the Northeast region of Brazil.