934 resultados para stages of development
Resumo:
Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)
Resumo:
This paper characterizes the developmental stages of the testes and vasa deferentia of the Panulirus echinatus Smith, 1869 through comparisons between microscopic findings, macroscopic aspects, and gonadosomatic index (GSR). The lobsters were sampled monthly (November 1999 to October 2000) using seine nets and a total of 1716 males were obtained at Tamandare Bay. Each carapace was cut to allow evaluation of the reproductive organs; the testes and vasa deferentia were dissected, weighed, fixed in Bouin`s solution up to 12 hours and submitted for histological analysis to determine the presence and/or absence of spermatozoa. These measures, along with change in color, size, diameter, development of the spermatophores and the GSR allowed the caracterization of three development stages: immature, intermediate and ripe. In conclusion, the maturity of the testes precedes the maturity of the vasa deferentia. To evaluate if gonadosomatic relation was a good quantitative indicator of the maturity stage, t tests (alpha = 0,05) were used and verified significant difference in the averages of GSR. The statistics corroborated that GSR can be used as indicative of the developmental stages for P. echinatus.
Resumo:
Steindachneridion parahybae is a freshwater catfish endemic to the Paraiba do Sul River and is classified as an endangered Neotropical species. An increasing number of conservation biologists are incorporating morphological and physiological research data to help conservation managers in rescue these endangered species. This study investigated the embryonic and larval development of S. parahybae in captivity, with emphasis in major events during the ontogeny of S. parahybae. Broodstocks were artificially induced to reproduce, and the extrusion occurred 200-255 degree-hours after hormonal induction at 24 degrees C. Larval ontogeny was evaluated every 10 minutes under microscopic/stereomicroscopic using fresh eggs samples. The main embryogenic development stages were identified: zygote, cleavage, including the morula, blastula, gastrula phase, organogenesis, and hatching. The extruded oocytes showed an average diameter of 1.10 +/- 0.10 mm, and after fertilization and hydration of eggs, the average diameter of eggs increased to about 1.90 +/- 0.60 mm, characterized by a large perivitelline space that persisted up to embryo development, the double chorion, and the poles (animal and vegetative). Cell division started about 2 minutes after fertilization (AF), resulting in 2, 4, 8 (4 x 2 arrangement of cells), 16 (4 x 4), 32 (4 x 8) and 64 (2 x 4 x 8) cells. Furthermore, the blastula and gastrula stages followed after these cells divisions. The closed blastopore occurred at 11 h 20 min AF; following the development, the organogenetic stages were identified and subdivided respectively in: early segmentation phase and late segmentation phase. In the early segmentation phase, there was the establishment of the embryonic axis, and it was possible to distinguish between the cephalic and caudal regions; somites, and the optic vesicles developed about 20 h AF. Total hatching occurred at 54 h AF, and the larvae average length was 4.30 +/- 0.70 mm. Gradual yolk sac reduction was observed during the first two days of larval development. The first feeding occurred at the end of the second day. During the larval phase, cannibalism, heterogeneous larval growth and photophobia were also observed. This information will be important in improving the artificial reproduction protocols of S. parahybae in controlled breeding programs.
Resumo:
Steindachneridion parahybae is a freshwater catfish endemic to the Paraíba do Sul River and is classified as an endangered Neotropical species. An increasing number of conservation biologists are incorporating morphological and physiological research data to help conservation managers in rescue these endangered species. This study investigated the embryonic and larval development of S. parahybae in captivity, with emphasis in major events during the ontogeny of S. parahybae. Broodstocks were artificially induced to reproduce, and the extrusion occurred 200-255 degree-hours after hormonal induction at 24°C. Larval ontogeny was evaluated every 10 minutes under microscopic/stereomicroscopic using fresh eggs samples. The main embryogenic development stages were identified: zygote, cleavage, including the morula, blastula, gastrula phase, organogenesis, and hatching. The extruded oocytes showed an average diameter of 1.10 ± 0.10 mm, and after fertilization and hydration of eggs, the average diameter of eggs increased to about 1.90 ± 0.60 mm, characterized by a large perivitelline space that persisted up to embryo development, the double chorion, and the poles (animal and vegetative). Cell division started about 2 minutes after fertilization (AF), resulting in 2, 4, 8 (4 x 2 arrangement of cells), 16 (4 x 4), 32 (4 x 8) and 64 (2 x 4 x 8) cells. Furthermore, the blastula and gastrula stages followed after these cells divisions. The closed blastopore occurred at 11 h 20 min AF; following the development, the organogenetic stages were identified and subdivided respectively in: early segmentation phase and late segmentation phase. In the early segmentation phase, there was the establishment of the embryonic axis, and it was possible to distinguish between the cephalic and caudal regions; somites, and the optic vesicles developed about 20 h AF. Total hatching occurred at 54 h AF, and the larvae average length was 4.30 ± 0.70 mm. Gradual yolk sac reduction was observed during the first two days of larval development. The first feeding occurred at the end of the second day. During the larval phase, cannibalism, heterogeneous larval growth and photophobia were also observed. This information will be important in improving the artificial reproduction protocols of S. parahybae in controlled breeding programs.
Resumo:
To compare the MANKIN and OARSI cartilage histopathology assessment systems using human articular cartilage from a large number of donors across the adult age spectrum representing all levels of cartilage degradation.
Resumo:
Sensitivity of marine crustaceans to anthropogenic CO2 emissions and the associated acidification of the oceans may be less than that of other, especially lower, invertebrates. However, effects on critical transition phases or carry-over effects between life stages have not comprehensively been explored. Here we report the impact of elevated seawater PCO2 values (3100 µatm) on Hyas araneus during the last 2 weeks of their embryonic development (pre-hatching phase) and during development while in the consecutive zoea I and zoea II larval stages (post-hatching phase). We measured oxygen consumption, dry weight, developmental time and mortality in zoea I to assess changes in performance. Feeding rates and survival under starvation were investigated at different temperatures to detect differences in thermal sensitivities of zoea I and zoea II larvae depending on pre-hatch history. When embryos were pre-exposed to elevated PCO2 during maternal care, mortality increased about 60% under continued CO2 exposure during the zoea I phase. The larvae that moulted into zoea II, displayed a developmental delay by about 20 days compared to larvae exposed to control PCO2 during embryonic and zoeal phases. Elevated PCO2 caused a reduction in zoea I dry weight and feeding rates, while survival of the starved larvae was not affected by the seawater CO2 concentration. In conclusion, CO2 effects on egg masses under maternal care carried over to the first larval stages of crustaceans and reduced their survival and development to levels below those previously reported in studies exclusively focussing on acute PCO2 effects on the larval stages.
Resumo:
Nonobese diabetic (NOD) mice develop insulin-dependent diabetes mellitus due to autoimmune T lymphocyte-mediated destruction of pancreatic β cells. Although both major histocompatibility complex class I-restricted CD8+ and class II-restricted CD4+ T cell subsets are required, the specific role each subset plays in the pathogenic process is still unclear. Here we show that class I-dependent T cells are required for all but the terminal stages of autoimmune diabetes development. To characterize the diabetogenic CD8+ T cells responsible, we isolated and propagated in vitro CD8+ T cells from the earliest insulitic lesions of NOD mice. They were cytotoxic to NOD islet cells, restricted to H-2Kd, and showed a diverse T cell receptor β chain repertoire. In contrast, their α chain repertoire was more restricted, with a recurrent amino acid sequence motif in the complementarity-determining region 3 loop and a prevalence of Vα17 family members frequently joined to the Jα42 gene segment. These results suggest that a number of the CD8+ T cells participating in the initial phase of autoimmune β cell destruction recognize a common structural component of Kd/peptide complexes on pancreatic β cells, possibly a single peptide.
Resumo:
The majority of T lymphocytes start to develop at around day 15 of gestation (d15)-d17 in the thymus and comprise the peripheral repertoire characterized by the expression of polymorphic T-cell antigen receptors (TCRs). Contrary to these conventional T cells, a subset of T cells, called natural killer (NK) T cells (most of them expressing an invariant TCR encoded by the Valpha14Jalpha281 gene with a 1-nt N-region), preferentially differentiates extrathymically and dominates the peripheral T-cell population at a high frequency (5% in splenic T cells and 40% in bone marrow T cells). Here, we investigated the development of NK T cells and found that the invariant Valpha14+ TCR transcripts and the circular DNA created by Valpha14 and Jalpha281 gene rearrangements can be detected in the embryo body at d9.5 of gestation and in the yolk sac and the fetal liver at d11.5-d13.5 of gestation, but not in the thymus, whereas T cells with Valpha1+ TCR expression, a major population in the thymus, were not observed at these early stages of gestation. Fluorescence-activated cell sorter analysis also demonstrated that there exist CD3+ alpha beta+ T cells, almost all of which are Valpha14/Vbeta8+ NK+ T cells, during early embryogenesis. To our knowledge, this demonstrates for the first time that a T lymphocyte subset develops in extrathymic tissues during the early stages of embryogenesis.
Resumo:
I. 1604-1825: pt. I. Catholic people and Catholic priests in colonial New England, by J. E. Sexton. pt. II. The organized Catholic church in Boston from its beginnings to the end of Bishop Cheverus' reign, by J. E. Sexton.--II. 1825-1866: pt. III. The diocese under Bishop Benedict Joseph Fenwick, S. J. (1825-1846) by R. H. Lord. pt. IV. The diocese under Bishop Bernard Fitzpatrick (1846-1866) by E. T. Harrington.--III. 1866-1943: pt. V. The archdiocese of Boston under the Most Reverend John Joseph Williams (1866-1907) by R. H. Lord. pt. VI. The archdiocese of Boston under His Eminence William cardinal O'Connell (1907-1943) by R. H. Lord.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.
Resumo:
The development of new drugs is one strategy for malaria control. Biochemical pathways localised in the apicoplast of the parasite, such as the synthesis of isoprenic precursors, are excellent targets because they are different or absent in the human host. Isoprenoids are a large and highly diverse group of natural products with many functions and their synthesis is essential for the parasite's survival. During the last few years, the genes, enzymes, intermediates and mechanisms of this biosynthetic route have been elucidated. In this review, we comment on some aspects of the methylerythritol phosphate pathway and discuss the presence of diverse isoprenic products such as dolichol, ubiquinone, carotenoids, menaquinone and isoprenylated proteins, which are biosynthesised during the intraerythrocytic stages of Plasmodium falciparum.
Resumo:
Stages of change assess individual motivation for lifestyle changes, contributing to the development of more effective intervention strategies. The objective of the present study was to identify factors associated with stages of change for lower intake of red meat and higher intake of vegetables in a cross-sectional analysis of 578 Japanese-Brazilians aged 30-90 years. In adjusted logistic regression models, the odds ratios for women (OR = 1.89; 95%CI: 1.154; 3.103) and physically active individuals (OR = 1.00; 95%CI: 1.000; 1.001) were positively associated with stage of "action" for the higher intake of vegetables. Inverse associations were observed between central obesity (OR = 0.5; 95%CI: 0.351; 0.887) and highest tertile of red meat intake (OR = 0.50; 95%CI: 0.302; 0.817), as well as a positive association between age (OR = 1.04; 95%CI: 1.020; 1.070) and the stage of "action" to the lower intake of meat were verified. Motivation for Japanese-Brazilians to change their food intake was linked to lifestyle. Stage of change is an important factor in mediating food intake behavior change.