927 resultados para silver-stained denaturing PAGE
Resumo:
This study focused on nuclear and nucleolar area changes in Malpighian tubule cells of Rhodnius prolixus, an hematophagous insect, vector of Chagas' disease. Male and female adult insects were dissected after a 28-day starvation period, as well as insects which had been fed again after a 30-day starvation period. Malpighian tubules were fixed and silver stained. In both, males and females, nucleolar fusions and regions of nucleolar corpuscles were observed to be differentially impregnated by silver during feeding stress. In the males and females that were fed again, nucleolar corpuscles were partially fusioned, indicating a slight recovery upon the 30-day starvation period. The changes observed in the nucleolar phenotype and in both nuclear and nucleolar areas indicated that, as a result of stress, a more intense, compensatory activity occurred to supply the metabolic rate. The mechanism of this phenomenon may be associated to the decondensation and activation of chromatin that carries rDNA in order to increase rRNA transcription, and,consequently, protein synthesis.
Resumo:
This study was performed in order to evaluate the detection limit of PCR with fluorescent capillary electrophoresis for Leptospira pomona diagnosis in bovine semen. Negative bovine semen samples were artificially contaminated with Leptospira pomona (10 0 to 10 7 bacteria/ ml) and DNA was extracted by phenol/chloroform protocol. DNA fragments visualization was done by three electrophoresis methods: under UV light in 2 % agarose gel, silver staining 8% polyacrylamide gel and fluorescent capillary electrophoresis. The detection limit of capillary electrophoresis for Leptospira pomona was 10 2bacteria/ml. Under UV light, in 2 % agarose gel, the detection limit was of 10 4 bacteria/ ml while for silver stained 8 % polyacrylamide gel it was 10 2 bacteria/ ml. PCR with fluorescent capillary electrophoresis is an efficient and rapid diagnostic test for DNA detection of Leptospira in bovine semen and this can be an important tool for herd and semen sanitary control in artificial insemination centers.
Resumo:
We examined the course of spermatogenesis and the meiotic chromosome complements in aquatic species of true bugs, Heteroptera. The chromosome complement of the Veliidae species was 2n = 39 (38A + X0) and 23 (22A + X0) in Rhagovelia whitei and Rhagovelia sp, respectively, and in the species of the Notonectidae (Martarega sp) it was 26 (22A + 2m + XY); all collected from the region of São José do Rio Preto, SP, Brazil. An impressive characteristic of the first analysis was the size of the cells belonging to Martarega sp, which were six times larger than the same cells in Pentatomidae and twice as large as the cells in aquatic Heteroptera (Gerridae). Regarding spermatogenesis, all the species analyzed showed the same pattern: holocentric chromosomes and elongated spermatids with the chromatin distributed evenly along the head. The family Veliidae showed several bodies impregnated with silver nitrate at prophase, while the family Notonectidae displayed only one. The cells of Notonectidae also showed an evident and round body until the end of prophase I and in the family Veliidae the silver-impregnated bodies were disorganized, where the only region visualized was possibly that of the NOR. In metaphase, silver-stained regions were found at the periphery of all chromosomes in Veliidae and at the periphery of some chromosomes in Notonectidae. The spermatids of Veliidae showed a less silver-impregnated vesicle, while Notonectidae showed silver staining only in part of the nuclear membrane. Therefore, families of Heteroptera have some differences and features that can help identify and classify these species.
Resumo:
Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)
Resumo:
Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)
Resumo:
This study was performed in order to evaluate the detection limit of PCR with fluorescent capillary electrophoresis for Brucella abortus diagnosis in bovine semen. Negative bovine semen samples were artificially contaminated with B. abortus (10(0) to 10(7) bacteria/mL) and DNA was extracted by phenol/chloroform protocol. DNA was amplified by PCR with oligonucleotides previously described BF-5'gcgctcaggctgccgacgcaa3' (6-FAM labeled) and BR-5'accagccattgcggtcggta3' for B. abortus. Oligonucleotides generated DNA fragments of 193 bp. DNA fragments visualization was done under UV light at silver stained 8% poliacrylamide gel, and fluorescent capillary electrophoresis performed in an automatic DNA fragment analyzer. The detection limit of capillary electrophoresis for B. abortus was 10³ bacteria/mL, while for silver stained 8% poliacrylamide gel it was 10(5) bacteria/mL. PCR with fluorescent capillary electrophoresis is fast, efficient and highly sensitive test for DNA detection of Brucella in bovine semen, and itcan be an important tool for health evaluation of the herd and semen sanitary control in artificial insemination centers.
Resumo:
Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)
Resumo:
Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)
Resumo:
Methodological evaluation of the proteomic analysis of cardiovascular-tissue material has been performed with a special emphasis on establishing examinations that allow reliable quantitative analysis of silver-stained readouts. Reliability, reproducibility, robustness and linearity were addressed and clarified. In addition, several types of normalization procedures were evaluated and new approaches are proposed. It has been found that the silver-stained readout offers a convenient approach for quantitation if a linear range for gel loading is defined. In addition, a broad range of a 10-fold input (loading 20-200 microg per gel) fulfills the linearity criteria, although at the lowest input (20 microg) a portion of protein species will remain undetected. The method is reliable and reproducible within a range of 65-200 microg input. The normalization procedure using the sum of all spot intensities from a silver-stained 2D pattern has been shown to be less reliable than other approaches, namely, normalization through median or through involvement of interquartile range. A special refinement of the normalization through virtual segmentation of pattern, and calculation of normalization factor for each stratum provides highly satisfactory results. The presented results not only provide evidence for the usefulness of silver-stained gels for quantitative evaluation, but they are directly applicable to the research endeavor of monitoring alterations in cardiovascular pathophysiology.
Resumo:
Metaphase nucleolar organizer regions (NORs), one of four types of chromosome bands, are located on human acrocentric chromosomes. They contain r-chromatin, i.e., ribosomal genes complexed with proteins such as upstream binding factor and RNA polymerase I, which are argyrophilic NOR proteins. Immunocytochemical and cytochemical labelings of these proteins were used to reveal r-chromatin in situ and to investigate its spatial organization within NORs by confocal microscopy and by electron tomography. For each labeling, confocal microscopy revealed small and large double-spotted NORs and crescent-shaped NORs. Their internal three-dimensional (3D) organization was studied by using electron tomography on specifically silver-stained NORs. The 3D reconstructions allow us to conclude that the argyrophilic NOR proteins are grouped as a fiber of 60–80 nm in diameter that constitutes either one part of a turn or two or three turns of a helix within small and large double-spotted NORs, respectively. Within crescent-shaped NORs, virtual slices reveal that the fiber constitutes several longitudinally twisted loops, grouped as two helical 250- to 300-nm coils, each centered on a nonargyrophilic axis of condensed chromatin. We propose a model of the 3D organization of r-chromatin within elongated NORs, in which loops are twisted and bent to constitute one basic chromatid coil.
Resumo:
A cDNA of pea (Pisum sativum L.) RbcS 3A, encoding a small subunit protein (S) of ribulose-1,5-bisphosphate carboxylase/oxygenase (Rubisco), has been expressed in Arabidopsis thaliana under control of the cauliflower mosaic virus 35S promoter, and the transcript and mature S protein were detected. Specific antibodies revealed two protein spots for the four Arabidopsis S and one additional spot for pea S. Pea S in chimeric Rubisco amounted to 15 to 18% of all S, as judged by separation on two-dimensional isoelectric focusing/sodium dodecyl sulfate-polyacrylamide gel electrophoresis gels from partially purified enzyme preparations and quantitation of silver-stained protein spots. The chimeric enzyme had 11 ± 1% fewer carbamylated sites and a 11 ± 1% lower carboxylase activity than wild-type Arabidopsis Rubisco. Whereas pea S expression, preprotein transport, and processing and assembly resulted in a stable holoenzyme, the chimeric enzyme was reproducibly catalytically less efficient. We suggest that the presence of, on average, one foreign S per holoenzyme is responsible for the altered activity. In addition, higher-plant Rubisco, unlike the cyanobacterial enzyme, seems to have evolved species-specific interactions between S and the large subunit protein that are involved in carbamylation of the active site.
Resumo:
1-Methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP) causes nigrostriatal dopaminergic pathway damage similar to that observed in Parkinson disease (PD). To study the role of NO radical in MPTP-induced neurotoxicity, we injected MPTP into mice in which nitric oxide synthase (NOS) was inhibited by 7-nitroindazole (7-NI) in a time- and dose-dependent fashion. 7-NI dramatically protected MPTP-injected mice against indices of severe injury to the nigrostriatal dopaminergic pathway, including reduction in striatal dopamine contents, decreases in numbers of nigral tyrosine hydroxylase-positive neurons, and numerous silver-stained degenerating nigral neurons. The resistance of 7-NI-injected mice to MPTP is not due to alterations in striatal pharmacokinetics or content of 1-methyl-4-phenylpyridinium ion (MPP+), the active metabolite of MPTP. To study specifically the role of neuronal NOS (nNOS), MPTP was administered to mutant mice lacking the nNOS gene. Mutant mice are significantly more resistant to MPTP-induced neurotoxicity compared with wild-type littermates. These results indicate that neuronally derived NO mediates, in part, MPTP-induced neurotoxicity. The similarity between the MPTP model and PD raises the possibility that NO may play a significant role in the etiology of PD.
Resumo:
There are very few data on trichodinids of freshwater fishes in Australia. 2003 fishes were surveyed across Eastern Australia to investigate the diversity of trichodinids present, to determine which species have been introduced with exotic fishes and to determine the extent to which these species have crossed into native fish Populations. Twenty-one putative trichodinid species were recovered from the 33 fish species examined. Trichodina heterodentata, T. mutabilis and T. reticulata were the exotic species recovered regularly; a single specimen matched a fourth exotic species, T acuta. All four exotic species are redescribed from Australian material. Trichodina heterodentata was recorded from 17 species of fishes, 15 of which were new host records; this species is identified as one of emerging importance in fish parasitology and a list of its known hosts is presented. Two new native species are also described based on silver stained specimens: T cribbi sp. n. from Hypseleotris galii, H. klunzingeri, and Hypseleotris sp. 5; and T. bassonae sp. n. from Selenotoca multifasciata. Trichodina cribbi is characterised by a large circular central inclusion and approximately 28 denticles, which have a blade length slightly greater than the ray length. Trichodina bassonae is characterised by a small, round, central inclusion and approximately 25 denticles, which have straight, non tapering rays that are in line with the leading edge of the denticle blade. It is estimated that the Australian trichodinid fauna may include up to 150 as yet undescribed species and represents a major source of unexplored biodiversity.
Resumo:
The topographic pattern of senile plaques (SP) and neurofibrillary tangles (NFT) was studied in silver stained coronal sections of neocortex and hippocampus in ten cases of Alzheimer's disease (AD). Both lesions showed evidence of clustering in the tissue with many of the clusters being regularly spaced. The patterns of SP and NFT were compared 1) in the same cortical zone, 2) between upper and lower zones of the cortex and 3) in regions connected by either association fibres or the perforant path. Correlations between the lesions in the same cortical zone were found in 20% of the layers examined while correlations between upper and lower zones occurred in 64% of cortical regions examined. There was evidence that NFT in upper and lower cortex may be in register in some tissues. In addition, positive correlations were found between upper NFT and lower SP and negative correlations between upper SP and lower NFT in some tissues. Regular clustering of lesions was also observed in brain regions connected to one another suggesting that they develop on functinally related sets of neurons.
Resumo:
Chronic experimental lung infection in rats was induced by intratracheal inoculation of agar beads containing Pseudomonas aeruginosa. Bacteria were recovered directly without subculture from the lungs of rats at 14 days post-infection and the outer membrane (OM) antigens were studied. The results indicated that bacteria grew under iron-restricted conditions as revealed by the expression of several iron-regulated membrane proteins (IRMPs) which could also be observed when the isolate was grown under iron-depleted conditions in laboratory media. The antibody response to P. aeruginosa OM protein antigens was investigated by immunoblotting with serum and lung fluid from infected rats. These fluids contained antibodies to all the major OM proteins, including the IRMPs, and protein H1. Results obtained using immunoblotting and enzyme-linked immunosorbent assay indicated that lipopolysaccharide (LPS) was the major antigen recognised by antibodies in sera from infected rats. The animal model was used to follow the development of the immune response to P. aeruginosa protein and LPS antigens. Immunoblotting was used to investigate the antigens recognised by antibodies in sequential serum samples. An antibody response to the IRMPs and OM proteins D, E, G and H1 and alao to rough LPS was detected as early as 4 days post-infection. Results obtained using immunoblotting and crossed immunoelectrophoresis techniques indicated that there was a progressive increase in the number of P. aeruginosa antigens recognised by antibodies in these sera. Both iron and magnesium depletion influenced protein H1 production. Antibodies in sera from patients with infections due to P. aeruginosa reacted with this antigen. Results obtained using quantitative gas-liquid chromatographic analysis indicated that growth phase and magnesium and iron depletion also affected the amount of LPS fatty acids, produced by P. aeruginosa. The silver stained SDS-polyacrylamide gels of proteinase K digested whole cell lysates of P. aeruginosa indicated that the O-antigen and core LPS were both affected by growth phase and specific nutrient depletion.