992 resultados para rail defect detection


Relevância:

30.00% 30.00%

Publicador:

Resumo:

Aims To evaluate the ability of multifocal transient pattern electroretinography (mfPERG) to detect neural loss and assess the relationship between mfPERG and visual-field (VF) loss in eyes with chiasmal compression. Methods 23 eyes from 23 patients with temporal VF defects and band atrophy of the optic nerve and 21 controls underwent standard automated perimetry and mfPERG using a stimulus pattern of 19 rectangles, each consisting of 12 squares. The response was determined for the central rectangle, for the nasal and temporal hemifields (eight rectangles each) and for each quadrant (three rectangles) in both patients and controls. Comparisons were made using variance analysis. Correlations between VF and mfPERG measurements were verified by linear regression analysis. Results Mean +/- SD mfPERG amplitudes from the temporal hemifield (0.50 +/- 0.17 and 0.62 +/- 0.32) and temporal quadrants (superior 0.42 +/- 0.21 and 0.52 +/- 0.35, inferior 0.51 +/- 0.23 and 0.74 +/- 0.40) were significantly lower in eyes with band atrophy than in controls (0.78 +/- 0.24, 0.89 +/- 0.28, 0.73 +/- 60.26, 0.96 +/- 0.36, 0.79 +/- 0.26 and 0.91 +/- 0.31, respectively). No significant difference was observed in nasal hemifield measurements. Significant correlations (0.36-0.73) were found between VF relative sensitivity and mfPERG amplitude in different VF sectors. Conclusions mfPERG amplitude measurements clearly differentiate eyes with temporal VF defect from controls. The good correlation between mfPERG amplitudes and the severity of VF defect suggests that mfPERG may be used as an indicator of ganglion cell dysfunction.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Iatrogenic atrial septal defects are described in 2 patients. They occurred after implantation of Amplatzer occluders to close a patent foramen ovale. While device erosions to the extra-atrial space have been described, erosion induced atrial septal defects are a new medical entity. They may be fairly common in the situation of an atrial septal aneurysm whipping the rim of the device incessantly. They are clinically silent and benign and require echocardiography for detection. A second device solved the problem in the cases described.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

We have developed a novel way to assess the mutagenicity of environmentally important metal carcinogens, such as nickel, by creating a positive selection system based upon the conditional expression of a retroviral transforming gene. The target gene is the v-mos gene in MuSVts110, a murine retrovirus possessing a growth temperature dependent defect in expression of the transforming gene due to viral RNA splicing. In normal rat kidney cells infected with MuSVts110 (6m2 cells), splicing of the MuSVts110 RNA to form the mRNA from which the transforming protein, p85$\sp{\rm gag-mos}$, is translated is growth-temperature dependent, occurring at 33 C and below but not at 39 C and above. This splicing "defect" is mediated by cis-acting viral sequences. Nickel chloride treatment of 6m2 cells followed by growth at 39 C, allowed the selection of "revertant" cells which constitutively express p85$\sp{\rm gag-mos}$ due to stable changes in the viral RNA splicing phenotype, suggesting that nickel, a carcinogen whose mutagenicity has not been well established, could induce mutations in mammalian genes. We also show by direct sequencing of PCR-amplified integrated MuSVts110 DNA from a 6m2 nickel-revertant cell line that the nickel-induced mutation affecting the splicing phenotype is a cis-acting 70-base duplication of a region of the viral DNA surrounding the 3$\sp\prime$ splice site. These findings provide the first example of the molecular basis for a nickel-induced DNA lesion and establish the mutagenicity of this potent carcinogen. ^

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Esta tesis doctoral se centra principalmente en técnicas de ataque y contramedidas relacionadas con ataques de canal lateral (SCA por sus siglas en inglés), que han sido propuestas dentro del campo de investigación académica desde hace 17 años. Las investigaciones relacionadas han experimentado un notable crecimiento en las últimas décadas, mientras que los diseños enfocados en la protección sólida y eficaz contra dichos ataques aún se mantienen como un tema de investigación abierto, en el que se necesitan iniciativas más confiables para la protección de la información persona de empresa y de datos nacionales. El primer uso documentado de codificación secreta se remonta a alrededor de 1700 B.C., cuando los jeroglíficos del antiguo Egipto eran descritos en las inscripciones. La seguridad de la información siempre ha supuesto un factor clave en la transmisión de datos relacionados con inteligencia diplomática o militar. Debido a la evolución rápida de las técnicas modernas de comunicación, soluciones de cifrado se incorporaron por primera vez para garantizar la seguridad, integridad y confidencialidad de los contextos de transmisión a través de cables sin seguridad o medios inalámbricos. Debido a las restricciones de potencia de cálculo antes de la era del ordenador, la técnica de cifrado simple era un método más que suficiente para ocultar la información. Sin embargo, algunas vulnerabilidades algorítmicas pueden ser explotadas para restaurar la regla de codificación sin mucho esfuerzo. Esto ha motivado nuevas investigaciones en el área de la criptografía, con el fin de proteger el sistema de información ante sofisticados algoritmos. Con la invención de los ordenadores se ha acelerado en gran medida la implementación de criptografía segura, que ofrece resistencia eficiente encaminada a obtener mayores capacidades de computación altamente reforzadas. Igualmente, sofisticados cripto-análisis han impulsado las tecnologías de computación. Hoy en día, el mundo de la información ha estado involucrado con el campo de la criptografía, enfocada a proteger cualquier campo a través de diversas soluciones de cifrado. Estos enfoques se han fortalecido debido a la unificación optimizada de teorías matemáticas modernas y prácticas eficaces de hardware, siendo posible su implementación en varias plataformas (microprocesador, ASIC, FPGA, etc.). Las necesidades y requisitos de seguridad en la industria son las principales métricas de conducción en el diseño electrónico, con el objetivo de promover la fabricación de productos de gran alcance sin sacrificar la seguridad de los clientes. Sin embargo, una vulnerabilidad en la implementación práctica encontrada por el Prof. Paul Kocher, et al en 1996 implica que un circuito digital es inherentemente vulnerable a un ataque no convencional, lo cual fue nombrado posteriormente como ataque de canal lateral, debido a su fuente de análisis. Sin embargo, algunas críticas sobre los algoritmos criptográficos teóricamente seguros surgieron casi inmediatamente después de este descubrimiento. En este sentido, los circuitos digitales consisten típicamente en un gran número de celdas lógicas fundamentales (como MOS - Metal Oxide Semiconductor), construido sobre un sustrato de silicio durante la fabricación. La lógica de los circuitos se realiza en función de las innumerables conmutaciones de estas células. Este mecanismo provoca inevitablemente cierta emanación física especial que puede ser medida y correlacionada con el comportamiento interno del circuito. SCA se puede utilizar para revelar datos confidenciales (por ejemplo, la criptografía de claves), analizar la arquitectura lógica, el tiempo e incluso inyectar fallos malintencionados a los circuitos que se implementan en sistemas embebidos, como FPGAs, ASICs, o tarjetas inteligentes. Mediante el uso de la comparación de correlación entre la cantidad de fuga estimada y las fugas medidas de forma real, información confidencial puede ser reconstruida en mucho menos tiempo y computación. Para ser precisos, SCA básicamente cubre una amplia gama de tipos de ataques, como los análisis de consumo de energía y radiación ElectroMagnética (EM). Ambos se basan en análisis estadístico y, por lo tanto, requieren numerosas muestras. Los algoritmos de cifrado no están intrínsecamente preparados para ser resistentes ante SCA. Es por ello que se hace necesario durante la implementación de circuitos integrar medidas que permitan camuflar las fugas a través de "canales laterales". Las medidas contra SCA están evolucionando junto con el desarrollo de nuevas técnicas de ataque, así como la continua mejora de los dispositivos electrónicos. Las características físicas requieren contramedidas sobre la capa física, que generalmente se pueden clasificar en soluciones intrínsecas y extrínsecas. Contramedidas extrínsecas se ejecutan para confundir la fuente de ataque mediante la integración de ruido o mala alineación de la actividad interna. Comparativamente, las contramedidas intrínsecas están integradas en el propio algoritmo, para modificar la aplicación con el fin de minimizar las fugas medibles, o incluso hacer que dichas fugas no puedan ser medibles. Ocultación y Enmascaramiento son dos técnicas típicas incluidas en esta categoría. Concretamente, el enmascaramiento se aplica a nivel algorítmico, para alterar los datos intermedios sensibles con una máscara de manera reversible. A diferencia del enmascaramiento lineal, las operaciones no lineales que ampliamente existen en criptografías modernas son difíciles de enmascarar. Dicho método de ocultación, que ha sido verificado como una solución efectiva, comprende principalmente la codificación en doble carril, que está ideado especialmente para aplanar o eliminar la fuga dependiente de dato en potencia o en EM. En esta tesis doctoral, además de la descripción de las metodologías de ataque, se han dedicado grandes esfuerzos sobre la estructura del prototipo de la lógica propuesta, con el fin de realizar investigaciones enfocadas a la seguridad sobre contramedidas de arquitectura a nivel lógico. Una característica de SCA reside en el formato de las fuentes de fugas. Un típico ataque de canal lateral se refiere al análisis basado en la potencia, donde la capacidad fundamental del transistor MOS y otras capacidades parásitas son las fuentes esenciales de fugas. Por lo tanto, una lógica robusta resistente a SCA debe eliminar o mitigar las fugas de estas micro-unidades, como las puertas lógicas básicas, los puertos I/O y las rutas. Las herramientas EDA proporcionadas por los vendedores manipulan la lógica desde un nivel más alto, en lugar de realizarlo desde el nivel de puerta, donde las fugas de canal lateral se manifiestan. Por lo tanto, las implementaciones clásicas apenas satisfacen estas necesidades e inevitablemente atrofian el prototipo. Por todo ello, la implementación de un esquema de diseño personalizado y flexible ha de ser tomado en cuenta. En esta tesis se presenta el diseño y la implementación de una lógica innovadora para contrarrestar SCA, en la que se abordan 3 aspectos fundamentales: I. Se basa en ocultar la estrategia sobre el circuito en doble carril a nivel de puerta para obtener dinámicamente el equilibrio de las fugas en las capas inferiores; II. Esta lógica explota las características de la arquitectura de las FPGAs, para reducir al mínimo el gasto de recursos en la implementación; III. Se apoya en un conjunto de herramientas asistentes personalizadas, incorporadas al flujo genérico de diseño sobre FPGAs, con el fin de manipular los circuitos de forma automática. El kit de herramientas de diseño automático es compatible con la lógica de doble carril propuesta, para facilitar la aplicación práctica sobre la familia de FPGA del fabricante Xilinx. En este sentido, la metodología y las herramientas son flexibles para ser extendido a una amplia gama de aplicaciones en las que se desean obtener restricciones mucho más rígidas y sofisticadas a nivel de puerta o rutado. En esta tesis se realiza un gran esfuerzo para facilitar el proceso de implementación y reparación de lógica de doble carril genérica. La viabilidad de las soluciones propuestas es validada mediante la selección de algoritmos criptográficos ampliamente utilizados, y su evaluación exhaustiva en comparación con soluciones anteriores. Todas las propuestas están respaldadas eficazmente a través de ataques experimentales con el fin de validar las ventajas de seguridad del sistema. El presente trabajo de investigación tiene la intención de cerrar la brecha entre las barreras de implementación y la aplicación efectiva de lógica de doble carril. En esencia, a lo largo de esta tesis se describirá un conjunto de herramientas de implementación para FPGAs que se han desarrollado para trabajar junto con el flujo de diseño genérico de las mismas, con el fin de lograr crear de forma innovadora la lógica de doble carril. Un nuevo enfoque en el ámbito de la seguridad en el cifrado se propone para obtener personalización, automatización y flexibilidad en el prototipo de circuito de bajo nivel con granularidad fina. Las principales contribuciones del presente trabajo de investigación se resumen brevemente a continuación: Lógica de Precharge Absorbed-DPL logic: El uso de la conversión de netlist para reservar LUTs libres para ejecutar la señal de precharge y Ex en una lógica DPL. Posicionamiento entrelazado Row-crossed con pares idénticos de rutado en redes de doble carril, lo que ayuda a aumentar la resistencia frente a la medición EM selectiva y mitigar los impactos de las variaciones de proceso. Ejecución personalizada y herramientas de conversión automática para la generación de redes idénticas para la lógica de doble carril propuesta. (a) Para detectar y reparar conflictos en las conexiones; (b) Detectar y reparar las rutas asimétricas. (c) Para ser utilizado en otras lógicas donde se requiere un control estricto de las interconexiones en aplicaciones basadas en Xilinx. Plataforma CPA de pruebas personalizadas para el análisis de EM y potencia, incluyendo la construcción de dicha plataforma, el método de medición y análisis de los ataques. Análisis de tiempos para cuantificar los niveles de seguridad. División de Seguridad en la conversión parcial de un sistema de cifrado complejo para reducir los costes de la protección. Prueba de concepto de un sistema de calefacción auto-adaptativo para mitigar los impactos eléctricos debido a la variación del proceso de silicio de manera dinámica. La presente tesis doctoral se encuentra organizada tal y como se detalla a continuación: En el capítulo 1 se abordan los fundamentos de los ataques de canal lateral, que abarca desde conceptos básicos de teoría de modelos de análisis, además de la implementación de la plataforma y la ejecución de los ataques. En el capítulo 2 se incluyen las estrategias de resistencia SCA contra los ataques de potencia diferencial y de EM. Además de ello, en este capítulo se propone una lógica en doble carril compacta y segura como contribución de gran relevancia, así como también se presentará la transformación lógica basada en un diseño a nivel de puerta. Por otra parte, en el Capítulo 3 se abordan los desafíos relacionados con la implementación de lógica en doble carril genérica. Así mismo, se describirá un flujo de diseño personalizado para resolver los problemas de aplicación junto con una herramienta de desarrollo automático de aplicaciones propuesta, para mitigar las barreras de diseño y facilitar los procesos. En el capítulo 4 se describe de forma detallada la elaboración e implementación de las herramientas propuestas. Por otra parte, la verificación y validaciones de seguridad de la lógica propuesta, así como un sofisticado experimento de verificación de la seguridad del rutado, se describen en el capítulo 5. Por último, un resumen de las conclusiones de la tesis y las perspectivas como líneas futuras se incluyen en el capítulo 6. Con el fin de profundizar en el contenido de la tesis doctoral, cada capítulo se describe de forma más detallada a continuación: En el capítulo 1 se introduce plataforma de implementación hardware además las teorías básicas de ataque de canal lateral, y contiene principalmente: (a) La arquitectura genérica y las características de la FPGA a utilizar, en particular la Xilinx Virtex-5; (b) El algoritmo de cifrado seleccionado (un módulo comercial Advanced Encryption Standard (AES)); (c) Los elementos esenciales de los métodos de canal lateral, que permiten revelar las fugas de disipación correlacionadas con los comportamientos internos; y el método para recuperar esta relación entre las fluctuaciones físicas en los rastros de canal lateral y los datos internos procesados; (d) Las configuraciones de las plataformas de pruebas de potencia / EM abarcadas dentro de la presente tesis. El contenido de esta tesis se amplia y profundiza a partir del capítulo 2, en el cual se abordan varios aspectos claves. En primer lugar, el principio de protección de la compensación dinámica de la lógica genérica de precarga de doble carril (Dual-rail Precharge Logic-DPL) se explica mediante la descripción de los elementos compensados a nivel de puerta. En segundo lugar, la lógica PA-DPL es propuesta como aportación original, detallando el protocolo de la lógica y un caso de aplicación. En tercer lugar, dos flujos de diseño personalizados se muestran para realizar la conversión de doble carril. Junto con ello, se aclaran las definiciones técnicas relacionadas con la manipulación por encima de la netlist a nivel de LUT. Finalmente, una breve discusión sobre el proceso global se aborda en la parte final del capítulo. El Capítulo 3 estudia los principales retos durante la implementación de DPLs en FPGAs. El nivel de seguridad de las soluciones de resistencia a SCA encontradas en el estado del arte se ha degenerado debido a las barreras de implantación a través de herramientas EDA convencionales. En el escenario de la arquitectura FPGA estudiada, se discuten los problemas de los formatos de doble carril, impactos parásitos, sesgo tecnológico y la viabilidad de implementación. De acuerdo con estas elaboraciones, se plantean dos problemas: Cómo implementar la lógica propuesta sin penalizar los niveles de seguridad, y cómo manipular un gran número de celdas y automatizar el proceso. El PA-DPL propuesto en el capítulo 2 se valida con una serie de iniciativas, desde características estructurales como doble carril entrelazado o redes de rutado clonadas, hasta los métodos de aplicación tales como las herramientas de personalización y automatización de EDA. Por otra parte, un sistema de calefacción auto-adaptativo es representado y aplicado a una lógica de doble núcleo, con el fin de ajustar alternativamente la temperatura local para equilibrar los impactos negativos de la variación del proceso durante la operación en tiempo real. El capítulo 4 se centra en los detalles de la implementación del kit de herramientas. Desarrollado sobre una API third-party, el kit de herramientas personalizado es capaz de manipular los elementos de la lógica de circuito post P&R ncd (una versión binaria ilegible del xdl) convertido al formato XDL Xilinx. El mecanismo y razón de ser del conjunto de instrumentos propuestos son cuidadosamente descritos, que cubre la detección de enrutamiento y los enfoques para la reparación. El conjunto de herramientas desarrollado tiene como objetivo lograr redes de enrutamiento estrictamente idénticos para la lógica de doble carril, tanto para posicionamiento separado como para el entrelazado. Este capítulo particularmente especifica las bases técnicas para apoyar las implementaciones en los dispositivos de Xilinx y su flexibilidad para ser utilizado sobre otras aplicaciones. El capítulo 5 se enfoca en la aplicación de los casos de estudio para la validación de los grados de seguridad de la lógica propuesta. Se discuten los problemas técnicos detallados durante la ejecución y algunas nuevas técnicas de implementación. (a) Se discute el impacto en el proceso de posicionamiento de la lógica utilizando el kit de herramientas propuesto. Diferentes esquemas de implementación, tomando en cuenta la optimización global en seguridad y coste, se verifican con los experimentos con el fin de encontrar los planes de posicionamiento y reparación optimizados; (b) las validaciones de seguridad se realizan con los métodos de correlación y análisis de tiempo; (c) Una táctica asintótica se aplica a un núcleo AES sobre BCDL estructurado para validar de forma sofisticada el impacto de enrutamiento sobre métricas de seguridad; (d) Los resultados preliminares utilizando el sistema de calefacción auto-adaptativa sobre la variación del proceso son mostrados; (e) Se introduce una aplicación práctica de las herramientas para un diseño de cifrado completa. Capítulo 6 incluye el resumen general del trabajo presentado dentro de esta tesis doctoral. Por último, una breve perspectiva del trabajo futuro se expone, lo que puede ampliar el potencial de utilización de las contribuciones de esta tesis a un alcance más allá de los dominios de la criptografía en FPGAs. ABSTRACT This PhD thesis mainly concentrates on countermeasure techniques related to the Side Channel Attack (SCA), which has been put forward to academic exploitations since 17 years ago. The related research has seen a remarkable growth in the past decades, while the design of solid and efficient protection still curiously remain as an open research topic where more reliable initiatives are required for personal information privacy, enterprise and national data protections. The earliest documented usage of secret code can be traced back to around 1700 B.C., when the hieroglyphs in ancient Egypt are scribed in inscriptions. Information security always gained serious attention from diplomatic or military intelligence transmission. Due to the rapid evolvement of modern communication technique, crypto solution was first incorporated by electronic signal to ensure the confidentiality, integrity, availability, authenticity and non-repudiation of the transmitted contexts over unsecure cable or wireless channels. Restricted to the computation power before computer era, simple encryption tricks were practically sufficient to conceal information. However, algorithmic vulnerabilities can be excavated to restore the encoding rules with affordable efforts. This fact motivated the development of modern cryptography, aiming at guarding information system by complex and advanced algorithms. The appearance of computers has greatly pushed forward the invention of robust cryptographies, which efficiently offers resistance relying on highly strengthened computing capabilities. Likewise, advanced cryptanalysis has greatly driven the computing technologies in turn. Nowadays, the information world has been involved into a crypto world, protecting any fields by pervasive crypto solutions. These approaches are strong because of the optimized mergence between modern mathematical theories and effective hardware practices, being capable of implement crypto theories into various platforms (microprocessor, ASIC, FPGA, etc). Security needs from industries are actually the major driving metrics in electronic design, aiming at promoting the construction of systems with high performance without sacrificing security. Yet a vulnerability in practical implementation found by Prof. Paul Kocher, et al in 1996 implies that modern digital circuits are inherently vulnerable to an unconventional attack approach, which was named as side-channel attack since then from its analysis source. Critical suspicions to theoretically sound modern crypto algorithms surfaced almost immediately after this discovery. To be specifically, digital circuits typically consist of a great number of essential logic elements (as MOS - Metal Oxide Semiconductor), built upon a silicon substrate during the fabrication. Circuit logic is realized relying on the countless switch actions of these cells. This mechanism inevitably results in featured physical emanation that can be properly measured and correlated with internal circuit behaviors. SCAs can be used to reveal the confidential data (e.g. crypto-key), analyze the logic architecture, timing and even inject malicious faults to the circuits that are implemented in hardware system, like FPGA, ASIC, smart Card. Using various comparison solutions between the predicted leakage quantity and the measured leakage, secrets can be reconstructed at much less expense of time and computation. To be precisely, SCA basically encloses a wide range of attack types, typically as the analyses of power consumption or electromagnetic (EM) radiation. Both of them rely on statistical analyses, and hence require a number of samples. The crypto algorithms are not intrinsically fortified with SCA-resistance. Because of the severity, much attention has to be taken into the implementation so as to assemble countermeasures to camouflage the leakages via "side channels". Countermeasures against SCA are evolving along with the development of attack techniques. The physical characteristics requires countermeasures over physical layer, which can be generally classified into intrinsic and extrinsic vectors. Extrinsic countermeasures are executed to confuse the attacker by integrating noise, misalignment to the intra activities. Comparatively, intrinsic countermeasures are built into the algorithm itself, to modify the implementation for minimizing the measurable leakage, or making them not sensitive any more. Hiding and Masking are two typical techniques in this category. Concretely, masking applies to the algorithmic level, to alter the sensitive intermediate values with a mask in reversible ways. Unlike the linear masking, non-linear operations that widely exist in modern cryptographies are difficult to be masked. Approved to be an effective counter solution, hiding method mainly mentions dual-rail logic, which is specially devised for flattening or removing the data-dependent leakage in power or EM signatures. In this thesis, apart from the context describing the attack methodologies, efforts have also been dedicated to logic prototype, to mount extensive security investigations to countermeasures on logic-level. A characteristic of SCA resides on the format of leak sources. Typical side-channel attack concerns the power based analysis, where the fundamental capacitance from MOS transistors and other parasitic capacitances are the essential leak sources. Hence, a robust SCA-resistant logic must eliminate or mitigate the leakages from these micro units, such as basic logic gates, I/O ports and routings. The vendor provided EDA tools manipulate the logic from a higher behavioral-level, rather than the lower gate-level where side-channel leakage is generated. So, the classical implementations barely satisfy these needs and inevitably stunt the prototype. In this case, a customized and flexible design scheme is appealing to be devised. This thesis profiles an innovative logic style to counter SCA, which mainly addresses three major aspects: I. The proposed logic is based on the hiding strategy over gate-level dual-rail style to dynamically overbalance side-channel leakage from lower circuit layer; II. This logic exploits architectural features of modern FPGAs, to minimize the implementation expenses; III. It is supported by a set of assistant custom tools, incorporated by the generic FPGA design flow, to have circuit manipulations in an automatic manner. The automatic design toolkit supports the proposed dual-rail logic, facilitating the practical implementation on Xilinx FPGA families. While the methodologies and the tools are flexible to be expanded to a wide range of applications where rigid and sophisticated gate- or routing- constraints are desired. In this thesis a great effort is done to streamline the implementation workflow of generic dual-rail logic. The feasibility of the proposed solutions is validated by selected and widely used crypto algorithm, for thorough and fair evaluation w.r.t. prior solutions. All the proposals are effectively verified by security experiments. The presented research work attempts to solve the implementation troubles. The essence that will be formalized along this thesis is that a customized execution toolkit for modern FPGA systems is developed to work together with the generic FPGA design flow for creating innovative dual-rail logic. A method in crypto security area is constructed to obtain customization, automation and flexibility in low-level circuit prototype with fine-granularity in intractable routings. Main contributions of the presented work are summarized next: Precharge Absorbed-DPL logic: Using the netlist conversion to reserve free LUT inputs to execute the Precharge and Ex signal in a dual-rail logic style. A row-crossed interleaved placement method with identical routing pairs in dual-rail networks, which helps to increase the resistance against selective EM measurement and mitigate the impacts from process variations. Customized execution and automatic transformation tools for producing identical networks for the proposed dual-rail logic. (a) To detect and repair the conflict nets; (b) To detect and repair the asymmetric nets. (c) To be used in other logics where strict network control is required in Xilinx scenario. Customized correlation analysis testbed for EM and power attacks, including the platform construction, measurement method and attack analysis. A timing analysis based method for quantifying the security grades. A methodology of security partitions of complex crypto systems for reducing the protection cost. A proof-of-concept self-adaptive heating system to mitigate electrical impacts over process variations in dynamic dual-rail compensation manner. The thesis chapters are organized as follows: Chapter 1 discusses the side-channel attack fundamentals, which covers from theoretic basics to analysis models, and further to platform setup and attack execution. Chapter 2 centers to SCA-resistant strategies against generic power and EM attacks. In this chapter, a major contribution, a compact and secure dual-rail logic style, will be originally proposed. The logic transformation based on bottom-layer design will be presented. Chapter 3 is scheduled to elaborate the implementation challenges of generic dual-rail styles. A customized design flow to solve the implementation problems will be described along with a self-developed automatic implementation toolkit, for mitigating the design barriers and facilitating the processes. Chapter 4 will originally elaborate the tool specifics and construction details. The implementation case studies and security validations for the proposed logic style, as well as a sophisticated routing verification experiment, will be described in Chapter 5. Finally, a summary of thesis conclusions and perspectives for future work are included in Chapter 5. To better exhibit the thesis contents, each chapter is further described next: Chapter 1 provides the introduction of hardware implementation testbed and side-channel attack fundamentals, and mainly contains: (a) The FPGA generic architecture and device features, particularly of Virtex-5 FPGA; (b) The selected crypto algorithm - a commercially and extensively used Advanced Encryption Standard (AES) module - is detailed; (c) The essentials of Side-Channel methods are profiled. It reveals the correlated dissipation leakage to the internal behaviors, and the method to recover this relationship between the physical fluctuations in side-channel traces and the intra processed data; (d) The setups of the power/EM testing platforms enclosed inside the thesis work are given. The content of this thesis is expanded and deepened from chapter 2, which is divided into several aspects. First, the protection principle of dynamic compensation of the generic dual-rail precharge logic is explained by describing the compensated gate-level elements. Second, the novel DPL is originally proposed by detailing the logic protocol and an implementation case study. Third, a couple of custom workflows are shown next for realizing the rail conversion. Meanwhile, the technical definitions that are about to be manipulated above LUT-level netlist are clarified. A brief discussion about the batched process is given in the final part. Chapter 3 studies the implementation challenges of DPLs in FPGAs. The security level of state-of-the-art SCA-resistant solutions are decreased due to the implementation barriers using conventional EDA tools. In the studied FPGA scenario, problems are discussed from dual-rail format, parasitic impact, technological bias and implementation feasibility. According to these elaborations, two problems arise: How to implement the proposed logic without crippling the security level; and How to manipulate a large number of cells and automate the transformation. The proposed PA-DPL in chapter 2 is legalized with a series of initiatives, from structures to implementation methods. Furthermore, a self-adaptive heating system is depicted and implemented to a dual-core logic, assumed to alternatively adjust local temperature for balancing the negative impacts from silicon technological biases on real-time. Chapter 4 centers to the toolkit system. Built upon a third-party Application Program Interface (API) library, the customized toolkit is able to manipulate the logic elements from post P&R circuit (an unreadable binary version of the xdl one) converted to Xilinx xdl format. The mechanism and rationale of the proposed toolkit are carefully convoyed, covering the routing detection and repairing approaches. The developed toolkit aims to achieve very strictly identical routing networks for dual-rail logic both for separate and interleaved placement. This chapter particularly specifies the technical essentials to support the implementations in Xilinx devices and the flexibility to be expanded to other applications. Chapter 5 focuses on the implementation of the case studies for validating the security grades of the proposed logic style from the proposed toolkit. Comprehensive implementation techniques are discussed. (a) The placement impacts using the proposed toolkit are discussed. Different execution schemes, considering the global optimization in security and cost, are verified with experiments so as to find the optimized placement and repair schemes; (b) Security validations are realized with correlation, timing methods; (c) A systematic method is applied to a BCDL structured module to validate the routing impact over security metric; (d) The preliminary results using the self-adaptive heating system over process variation is given; (e) A practical implementation of the proposed toolkit to a large design is introduced. Chapter 6 includes the general summary of the complete work presented inside this thesis. Finally, a brief perspective for the future work is drawn which might expand the potential utilization of the thesis contributions to a wider range of implementation domains beyond cryptography on FPGAs.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Transportation Systems Center, Cambridge, Mass.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

National Highway Traffic Safety Administration, Office of Research and Development, Washington, D.C.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

This thesis considers two basic aspects of impact damage in composite materials, namely damage severity discrimination and impact damage location by using Acoustic Emissions (AE) and Artificial Neural Networks (ANNs). The experimental work embodies a study of such factors as the application of AE as Non-destructive Damage Testing (NDT), and the evaluation of ANNs modelling. ANNs, however, played an important role in modelling implementation. In the first aspect of the study, different impact energies were used to produce different level of damage in two composite materials (T300/914 and T800/5245). The impacts were detected by their acoustic emissions (AE). The AE waveform signals were analysed and modelled using a Back Propagation (BP) neural network model. The Mean Square Error (MSE) from the output was then used as a damage indicator in the damage severity discrimination study. To evaluate the ANN model, a comparison was made of the correlation coefficients of different parameters, such as MSE, AE energy, AE counts, etc. MSE produced an outstanding result based on the best performance of correlation. In the second aspect, a new artificial neural network model was developed to provide impact damage location on a quasi-isotropic composite panel. It was successfully trained to locate impact sites by correlating the relationship between arriving time differences of AE signals at transducers located on the panel and the impact site coordinates. The performance of the ANN model, which was evaluated by calculating the distance deviation between model output and real location coordinates, supports the application of ANN as an impact damage location identifier. In the study, the accuracy of location prediction decreased when approaching the central area of the panel. Further investigation indicated that this is due to the small arrival time differences, which defect the performance of ANN prediction. This research suggested increasing the number of processing neurons in the ANNs as a practical solution.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The section of CN railway between Vancouver and Kamloops runs along the base of many hazardous slopes, including the White Canyon, which is located just outside the town of Lytton, BC. The slope has a history of frequent rockfall activity, which presents a hazard to the railway below. Rockfall inventories can be used to understand the frequency-magnitude relationship of events on hazardous slopes, however it can be difficult to consistently and accurately identify rockfall source zones and volumes on large slopes with frequent activity, leaving many inventories incomplete. We have studied this slope as a part of the Canadian Railway Ground Hazard Research Program and have collected remote sensing data, including terrestrial laser scanning (TLS), photographs, and photogrammetry data since 2012, and used change detection to identify rockfalls on the slope. The objective of this thesis is to use a subset of this data to understand how rockfalls identified from TLS data could be used to understand the frequency-magnitude relationship of rockfalls on the slope. This includes incorporating both new and existing methods to develop a semi-automated workflow to extract rockfall events from the TLS data. We show that these methods can be used to identify events as small as 0.01 m3 and that the duration between scans can have an effect on the frequency-magnitude relationship of the rockfalls. We also show that by incorporating photogrammetry data into our analysis, we can create a 3D geological model of the slope and use this to classify rockfalls by lithology, to further understand the rockfall failure patterns. When relating the rockfall activity to triggering factors, we found that the amount of precipitation occurring over the winter has an effect on the overall rockfall frequency for the remainder of the year. These results can provide the railways with a more complete inventory of events compared to records created through track inspection, or rockfall monitoring systems that are installed on the slope. In addition, we can use the database to understand the spatial and temporal distribution of events. The results can also be used as an input to rockfall modelling programs.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

An unusual presentation of a focal osteoporotic bone marrow defect (FOBMD) of the mandible mimicking a cystic lesion is documented. A definitive diagnosis could be established only on the basis of the histopathologic evaluation. A 66-year-old Brazilian woman was referred by her dentist for well-defined radiolucency of the mandibular molar region suggesting a cystic lesion of odontogenic origin. The computed tomography scan confirmed that the lesion did not affect the corticals. The biopsy confirmed the diagnosis of FOBMD. The diagnostic difficulty in the current case is obvious, because FOBMD, usually exhibiting an ill-defined radiolucency, is seldom suspected preoperatively when a differential diagnosis is considered for focal well-defined radiolucent areas in the jaws.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

To assess binocular detection grating acuity using the LEA GRATINGS test to establish age-related norms in healthy infants during their first 3 months of life. In this prospective, longitudinal study of healthy infants with clear red reflex at birth, responses to gratings were measured at 1, 2, and 3 months of age using LEA gratings at a distance of 28 cm. The results were recorded as detection grating acuity values, which were arranged in frequency tables and converted to a one-octave scale for statistical analysis. For the repeated measurements, analysis of variance (ANOVA) was used to compare the detection grating acuity results between ages. A total of 133 infants were included. The binocular responses to gratings showed development toward higher mean values and spatial frequencies, ranging from 0.55 ± 0.70 cycles per degree (cpd), or 1.74 ± 0.21 logMAR, in month 1 to 3.11 ± 0.54 cpd, or 0.98 ± 0.16 logMAR, in month 3. Repeated ANOVA indicated differences among grating acuity values in the three age groups. The LEA GRATINGS test allowed assessment of detection grating acuity and its development in a cohort of healthy infants during their first 3 months of life.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A novel capillary electrophoresis method using capacitively coupled contactless conductivity detection is proposed for the determination of the biocide tetrakis(hydroxymethyl)phosphonium sulfate. The feasibility of the electrophoretic separation of this biocide was attributed to the formation of an anionic complex between the biocide and borate ions in the background electrolyte. Evidence of this complex formation was provided by (11) B NMR spectroscopy. A linear relationship (R(2) = 0.9990) between the peak area of the complex and the biocide concentration (50-900 μmol/L) was found. The limit of detection and limit of quantification were 15.0 and 50.1 μmol/L, respectively. The proposed method was applied to the determination of tetrakis(hydroxymethyl)phosphonium sulfate in commercial formulations, and the results were in good agreement with those obtained by the standard iodometric titration method. The method was also evaluated for the analysis of tap water and cooling water samples treated with the biocide. The results of the recovery tests at three concentration levels (300, 400, and 600 μmol/L) varied from 75 to 99%, with a relative standard deviation no higher than 9%.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Infections of the central nervous systems (CNS) present a diagnostic problem for which an accurate laboratory diagnosis is essential. Invasive practices, such as cerebral biopsy, have been replaced by obtaining a polymerase chain reaction (PCR) diagnosis using cerebral spinal fluid (CSF) as a reference method. Tests on DNA extracted from plasma are noninvasive, thus avoiding all of the collateral effects and patient risks associated with CSF collection. This study aimed to determine whether plasma can replace CSF in nested PCR analysis for the detection of CNS human herpesvirus (HHV) diseases by analysing the proportion of patients whose CSF nested PCR results were positive for CNS HHV who also had the same organism identified by plasma nested PCR. In this study, CSF DNA was used as the gold standard, and nested PCR was performed on both types of samples. Fifty-two patients with symptoms of nervous system infection were submitted to CSF and blood collection. For the eight HHV, one positive DNA result-in plasma and/or CSF nested PCR-was considered an active HHV infection, whereas the occurrence of two or more HHVs in the same sample was considered a coinfection. HHV infections were positively detected in 27/52 (51.9%) of the CSF and in 32/52 (61.5%) of the plasma, difference not significant, thus nested PCR can be performed on plasma instead of CSF. In conclusion, this findings suggest that plasma as a useful material for the diagnosis of cases where there is any difficulty to perform a CSF puncture.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The aim of this study was to develop a methodology using Raman hyperspectral imaging and chemometric methods for identification of pre- and post-blast explosive residues on banknote surfaces. The explosives studied were of military, commercial and propellant uses. After the acquisition of the hyperspectral imaging, independent component analysis (ICA) was applied to extract the pure spectra and the distribution of the corresponding image constituents. The performance of the methodology was evaluated by the explained variance and the lack of fit of the models, by comparing the ICA recovered spectra with the reference spectra using correlation coefficients and by the presence of rotational ambiguity in the ICA solutions. The methodology was applied to forensic samples to solve an automated teller machine explosion case. Independent component analysis proved to be a suitable method of resolving curves, achieving equivalent performance with the multivariate curve resolution with alternating least squares (MCR-ALS) method. At low concentrations, MCR-ALS presents some limitations, as it did not provide the correct solution. The detection limit of the methodology presented in this study was 50μgcm(-2).

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A rapid and low cost method to determine Cr(VI) in soils based upon alkaline metal extraction at room temperature is proposed as a semi-quantitative procedure to be performed in the field. A color comparison with standards with contents of Cr(VI) in the range of 10 to 150 mg kg-1 was used throughout. For the different types of soils studied, more than 75% of the fortified soluble Cr(VI) were recovered for all levels of spike tested for both the proposed and standard methods. Recoveries of 83 and 99% were obtained for the proposed and the standard methods, respectively, taking into account the analysis of a heavily contaminated soil sample.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.