Isolation of DNA sequences with homology to a degenerate FaRP oligonucleotide from the crayfish Procambarus clarkii

The neuropeptide Th1RFamide with the sequence Phe-Met-Arg-Phe-amide was originally isolated in the clam Macrocallista nimbosa (price and Greenberg, 1977). Since its discovery, a large family ofFl\1RFamide-related peptides termed FaRPs have been found to be present in all major animal phyla with functions ranging from modulation of neuronal activity to alteration of muscular contractions. However, little is known about the genetics encoding these peptides, especially in invertebrates. As FaRP-encoding genes have yet to be investigated in the invertebrate Malacostracean subphylum, the isolation and characterization ofFaRP-encoding DNA and mRNA was pursued in this project. The immediate aims of this thesis were: (1) to amplify mRNA sequences of Procambarus clarkii using a degenerate oligonucleotide primer deduced from the common amino acid sequence ofisolated Procambarus FaRPS, (2) to determine if these amplification products encode FaRP gene sequences, and (3) to create a selective cDNA library of sequences recognized by the degenerate oligonucleotide primer. The polymerase chain reaction - rapid amplification of cDNA ends (PCR-RACE) is a procedure in which a single gene-specific primer is used in conjunction with a generalized 3' or 5' primer to amplify copies ofthe region between a single point in the transcript and the 3' or 5' end of cDNA of interest (Frohman et aI., 1988). PCRRACE reactions were optimized with respect to primers used, buffer composition, cycle number, nature ofgenetic substrate to be amplified, annealing, extension and denaturation temperatures and times, and use of reamplification procedures. Amplification products were cloned into plasmid vectors and recombinant products were isolated, as were the recombinant plaques formed in the selective cDNA library. Labeled amplification products were hybridized to recombinant bacteriophage to determine ligated amplification product presence. When sequenced, the five isolated PCR-RACE amplification products were determined not to possess FaRP-encoding sequences. The 200bp, 450bp, and 1500bp sequences showed homology to the Caenorhabditis elegans cosmid K09A11, which encodes for cytochrome P450; transfer-RNA; transposase; and tRNA-Tyr, while the 500bp and 750bp sequences showed homology with the complete genome of the Vaccinia virus. Under the employed amplification conditions the degenerate oligonucleotide primer was observed to bind to and to amplify sequences with either 9 or 10bp of 17bp identity. The selective cDNA library was obselVed to be of extremely low titre. When library titre was increased, white. plaques were isolated. Amplification analysis of eight isolated Agt11 sequences from these plaques indicated an absence of an insertion sequence. The degenerate 17 base oligonucleotide primer synthesized from the common amino acid sequence ofisolated Procambarus FaRPs was thus determined to be non-specific in its binding under the conditions required for its use, and to be insufficient for the isolation and identification ofFaRP-encoding sequences. A more specific primer oflonger sequence, lower degeneracy, and higher melting temperature (TJ is recommended for further investigation into the FaRP-encoding genes of Procambarlls clarkii.

A degenerate primer allows amplification of part of the 3 '-terminus of three distinct carlavirus species

Sequences of the coat protein amino acids of definitive and tentative species of carlaviruses deposited in GenBank were aligned and a region of seven amino acids (GLGVPTE) was found to be conserved. The corresponding nucleotides were aligned, allowing the design of a degenerate primer that together with an oligo dT anti-sense primer, was effective for the detection of three distinct carlavirus species, two transmitted by aphids and one by whitefly. These primers have the advantage that about 940 nt from the 3'-terminus, comprising part of the CP gene (about 60%), the 11 K gene, and the terminal untranslated region can be amplified for sequencing. The fact that this amino acid sequence is conserved in almost all of the sequenced carlaviruses, allows the prediction that this primer pair will be useful as a diagnostic tool for carlavirus species. (C) 2007 Elsevier B.V. All rights reserved.

Polymerase recognition of synthetic oligodeoxyribonucleotides incorporating degenerate pyrimidine and purine bases

A universal base that is capable of substituting for any of the four natural bases in DNA would be of great utility in both mutagenesis and recombinant DNA experiments. This paper describes the properties of oligonucleotides incorporating two degenerate bases, the pyrimidine base 6H,8H-3,4-dihydropyrimido[4,5-c][1,2]oxazin-7-one and the purine base N6-methoxy-2,6-diaminopurine, designated P and K, respectively. An equimolar mixture of the analogues P and K (called M) acts, in primers, as a universal base. The thermal stability of oligonucleotide duplexes were only slightly reduced when natural bases were replaced by P or K. Templates containing the modified bases were copied by Taq polymerase; P behaved as thymine in 60% of copying events and as cytosine in 40%, whereas K behaved as if it were guanine (13%) or adenine (87%). The dUTPase gene of Caenorhabditis elegans, which we have found to contain three nonidentical homologous repeats, was used as a model system to test the use of these bases in primers for DNA synthesis. A pair of oligodeoxyribonucleotides, each 20 residues long and containing an equimolar mixture of P and K at six positions, primed with high specificity both T7 DNA polymerase in sequencing reactions and Taq polymerase in PCRs; no nonspecific amplification was obtained on genomic DNA of C. elegans. Use of P and K can significantly reduce the complexity of degenerate oligonucleotide mixtures, and when used together, P and K can act as a universal base.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Variations in the sensitivity of different primers for detecting Wolbachia in Anastrepha (diptera: tephritidae)

Wolbachia are endosymbiont bacteria of the family Rickettsiacea that are widespread in invertebrates and occur between 20% and 60% of Neotropical insects. These bacteria are responsible for reproductive phenomena such as cytoplasmic incompatibility, male killing, feminization and parthenogenesis. Supergroups A and B of Wolbachia are common in insects and can be identified using primers for 16S rDNA, ftsZ and wsp; these primers vary in their ability to detect Wolbachia. The ftsZ primer was the first primer used to detect Wolbachia in Anastrepha fruit flies. The primers for 16S rDNA, ftsZ and wsp and the corresponding PCR conditions have been optimized to study the distribution of Wolbachia and their effect on the biology of Anastrepha in Brazil. In this work, we examined the ability of these primers to detect Wolbachia in Anastrepha populations from three regions in the State of São Paulo, southeastern Brazil. All of the samples were positive for Wolbachia supergroup A when screened with primers for 16S A rDNA and wsp A; the wsp B primer also gave a positive result, indicating cross-reactivity. The ftsZ primer showed a poor ability to detect Wolbachia in Anastrepha and generated false negatives in 44.9% of the samples. These findings indicate that reliable PCR detection of Wolbachia requires the use of primers for 16S rDNA and wsp to avoid cross-reactions and false negatives, and that the ftsZ primer needs to be redesigned to improve its selectivity.

Molecular detection and differentiation of Brazilian and African isolates of the entomopathogen Neozygites tanajoae (Entomophthorales: Neozygitaceae) with PCR using specific primers

Neozygites tanajoae is an entomopathogenic fungus which has been used for biocontrol of the cassava green mite (Mononychellus tanajoa, CGM) in Africa. Establishment and dispersal of Brazilian isolates which have been introduced into some African countries in recent years to improve CGM control was followed with specific PCR assays. Two primer pairs, NEOSSU_F/NEOSSU_R and 8DDC_F/8DDC_R, were used to differentiate isolates collected from several locations in Brazil and from three countries in Africa, Benin, Ghana and Tanzania. The first primer pair enabled the species-specific detection of Neozygites tanajoae, while the second differentiated the Brazilian isolates from those of other geographical origin. PCR assays were designed for detection of fungal DNA in the matrix of dead infested mites since N. tanajoae is difficult to isolate and culture on selective artificial media. Our results show that all isolates (Brazilian and African) that sporulated on mummified mites were amplified with the first primer pair confirming their Neozygites tanajoae identity. The second pair amplified DNA from all the Brazilian isolates, but did not amplify any DNA samples from the African isolates. None of the two primers showed amplification neither from any of the non-sporulating mite extracts nor from the dead uninfected mites used as negative controls. We confirmed that the two primer pairs tested are suitable for the detection and differential identification of N. tanajoae isolates from Brazil and Africa and that they are useful to monitor the establishment and spread of the Brazilian isolates of N. tanajoae introduced into Benin or into other African countries for improvement of CGM biocontrol.

Development and characterization of microsatellite markers for Psychotria tenuinervis (Rubiaceae), a shrub species from the Atlantic forest, and primers transferability from Coffea

The shrub species Psychotria tenuinervis (Rubiaceae) is native to the Brazilian Atlantic forest and is largely found within natural and disturbed forest fragments. Aiming to develop studies on population genetic structure of forest fragment species, eigth microsatellite markers were developed for P. tenuinervis. Also, 15 loci already developed for Coffea (Rubiaceae) were tested for transferability to this species. We utilized 45 individuals from natural populations of three different fragments-anthropic edge, interior fragment and natural edge, within the Brazilian Atlantic forest. The average number of alleles per locus was 2.5 (two-four alleles/locus). These loci will be useful for future population genetic studies aiming to the conservation and management of this species.

Nucleotide sequence of the nifH gene coding for nitrogen reductase in the acetic acid bacterium Acetobacter diazotrophicus

The nifH gene sequence of the nitrogen-fixing bacterium Acetobacter diazotrophicus was determined with the use of the polymerase chain reaction and universal degenerate oligonucleotide primers. The gene shows highest pair-wise similarity to the nifH gene of Azospirillum brasilense. The phylogenetic relationships of the nifH gene sequences were compared with those inferred from 16S rRNA gene sequences. Knowledge of the sequence of the nifH gene contributes to the growing database of nifH gene sequences, and will allow the detection of Acet. diazotrophicus from environmental samples with nifH gene-based primers.

Expression of POU, Sox, and Pax genes in the brain ganglia of the tropical abalone Haliotis asinina

In gastropod mollusks, neuroendocrine cells in the anterior ganglia have been shown to regulate growth and reproduction. As a first step toward understanding the molecular mechanisms underlying the regulation of these physiological processes in the tropical abalone Haliotis asinina, ive have identified sets of POU, Sox, and Pax transcription factor genes that are expressed in these ganglia. Using highly degenerate oligonucleotide primers designed to anneal to conserved codons in each of these gene families, we have amplified by reverse transcriptase polymerase chain reaction 2 POU genes (HasPOU-III and HasPOU-IV), 2 Sox genes (HasSox-B and HasSox-C), and two Pax genes (HasPax-258 and HaxPax-6). Analyses with gene-specific primers indicated that the 6 genes are expressed in the cerebral and pleuropedal ganglia of both reproductively active and spent adults, in a number of sensory structures, and in a subset of other adult tissues.

EXISTENCE RESULTS FOR ABSTRACT DEGENERATE NEUTRAL FUNCTIONAL DIFFERENTIAL EQUATIONS

In this paper we discuss the existence of solutions for a class of abstract degenerate neutral functional differential equations. Some applications to partial differential equations are considered.

A novel method for development of species and strain-specific DNA probes and PCR primers for identifying Burkholderia solanacearum (formerly Pseudomonas solanacearum)

Six Burkholderia solanacearum (formerly Pseudomonas solanacearum) genomic DNA fragments were isolated, using RAPD techniques and cloning, from the three genetically diverse strains: ACH092 (Biovar 4), ACH0158 (Biovar 2) and ACH0171 (Biovar 3) (1). One of these cloned fragments was selected because it was present constantly in all bacterial strains analysed. The remaining five clones were selected because Southern hybridisation revealed that each showed partial or complete specificity towards the strain of origin. A seventh genomic fragment showing a strain-specific distribution in Southern hybridisations was obtained by differential restriction, hybridisation and cloning of genomic DNA. Each of these clones was sequenced and primers to amplify the insert were designed. When DNA from the strain of origin was used as template, PCR amplification for each of these fragments yielded a single band on gel analysis. One pair of primers amplified the species-constant fragment of 281 bp from DNA of all B. solanacearum strains investigated, from DNA of the closely related bacterium which causes ''blood disease'' of banana (BDB) and in P. syzigii. The sensitivity of detection of B. solanacearum using these ubiquitous primers was between 1.3 and 20 bacterial cells. The feasibility and reliability of a PCR approach to detection and identification of B. solanacearum was tested in diverse strains of the bacterium in several countries and laboratories.

Application of inter simple sequence repeat (ISSR) markers to plant genetics

Microsatellites or simple sequence repeats (SSRs) are ubiquitous in eukaryotic genomes. Single-locus SSR markers have been developed for a number of species, although there is a major bottleneck in developing SSR markers whereby flanking sequences must be known to design 5'-anchors for polymerase chain reaction (PCR) primers. Inter SSR (ISSR) fingerprinting was developed such that no sequence knowledge was required. Primers based on a repeat sequence, such as (CA)(n), can be made with a degenerate 3'-anchor, such as (CA)(8)RG or (AGC)(6)TY. The resultant PCR reaction amplifies the sequence between two SSRs, yielding a multilocus marker system useful for fingerprinting, diversity analysis and genome mapping. PCR products are radiolabelled with P-32 or P-33 via end-labelling or PCR incorporation, and separated on a polyacrylamide sequencing gel prior to autoradiographic visualisation. A typical reaction yields 20-100 bands per lane depending on the species and primer. We have used ISSR fingerprinting in a number of plant species, and report here some results on two important tropical species, sorghum and banana. Previous investigators have demonstrated that ISSR analysis usually detects a higher level of polymorphism than that detected with restriction fragment length polymorphism (RFLP) or random amplified polymorphic DNA (RAPD) analyses. Our data indicate that this is not a result of greater polymorphism genetically, but rather technical reasons related to the detection methodology used for ISSR analysis.