1000 resultados para crop detection


Relevância:

30.00% 30.00%

Publicador:

Resumo:

Adjusting N fertilizer application to crop requirements is a key issue to improve fertilizer efficiency, reducing unnecessary input costs to farmers and N environmental impact. Among the multiple soil and crop tests developed, optical sensors that detect crop N nutritional status may have a large potential to adjust N fertilizer recommendation (Samborski et al. 2009). Optical readings are rapid to take and non-destructive, they can be efficiently processed and combined to obtain indexes or indicators of crop status. However, other physiological stress conditions may interfere with the readings and detection of the best crop nutritional status indicators is not always and easy task. Comparison of different equipments and technologies might help to identify strengths and weakness of the application of optical sensors for N fertilizer recommendation. The aim of this study was to evaluate the potential of various ground-level optical sensors and narrow-band indices obtained from airborne hyperspectral images as tools for maize N fertilizer recommendations. Specific objectives were i) to determine which indices could detect differences in maize plants treated with different N fertilizer rates, and ii) to evaluate its ability to identify N-responsive from non-responsive sites.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The potential for large-scale use of a sensitive real time reverse transcription polymerase chain reaction (RT-PCR) assay was evaluated for the detection of Tomato spotted wilt virus (TSWV) in single and bulked leaf samples by comparing its sensitivity with that of DAS-ELISA. Using total RNA extracted with RNeasy (R) or leaf soak methods, real time RT-PCR detected TSWV in all infected samples collected from 16 horticultural crop species (including flowers, herbs and vegetables), two arable crop species, and four weed species by both assays. In samples in which DAS-ELISA had previously detected TSWV, real time RT-PCR was effective at detecting it in leaf tissues of all 22 plant species tested at a wide range of concentrations. Bulk samples required more robust and extensive extraction methods with real time RT-PCR, but it generally detected one infected sample in 1000 uninfected ones. By contrast, ELISA was less sensitive when used to test bulked samples, once detecting up to I infected in 800 samples with pepper but never detecting more than I infected in 200 samples in tomato and lettuce. It was also less reliable than real time RT-PCR when used to test samples from parts of the leaf where the virus concentration was low. The genetic variability among Australian isolates of TSWV was small. Direct sequencing of a 587 bp region of the nucleoprotein gene (S RNA) of 29 isolates from diverse crops and geographical locations yielded a maximum of only 4.3% nucleotide sequence difference. Phylogenetic analysis revealed no obvious groupings of isolates according to geographic origin or host species. TSWV isolates, that break TSWV resistance genes in tomato or pepper did not differ significantly in the N gene region studied, indicating that a different region of the virus genome is responsible for this trait.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

On-site detection of inoculum of polycyclic plant pathogens could potentially contribute to management of disease outbreaks. A 6-min, in-field competitive immunochromatographic lateral flow device (CLFD) assay was developed for detection of Alternaria brassicae (the cause of dark leaf spot in brassica crops) in air sampled above the crop canopy. Visual recording of the test result by eye provides a detection threshold of approximately 50 dark leaf spot conidia. Assessment using a portable reader improved test sensitivity. In combination with a weather-driven infection model, CLFD assays were evaluated as part of an in-field risk assessment to identify periods when brassica crops were at risk from A. brassicae infection. The weather-driven model overpredicted A. brassicae infection. An automated 7-day multivial cyclone air sampler combined with a daily in-field CLFD assay detected A. brassicae conidia air samples from above the crops. Integration of information from an in-field detection system (CLFD) with weather-driven mathematical models predicting pathogen infection have the potential for use within disease management systems.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Crop monitoring and more generally land use change detection are of primary importance in order to analyze spatio-temporal dynamics and its impacts on environment. This aspect is especially true in such a region as the State of Mato Grosso (south of the Brazilian Amazon Basin) which hosts an intensive pioneer front. Deforestation in this region as often been explained by soybean expansion in the last three decades. Remote sensing techniques may now represent an efficient and objective manner to quantify how crops expansion really represents a factor of deforestation through crop mapping studies. Due to the special characteristics of the soybean productions' farms in Mato Grosso (area varying between 1000 hectares and 40000 hectares and individual fields often bigger than 100 hectares), the Moderate Resolution Imaging Spectroradiometer (MODIS) data with a near daily temporal resolution and 250 m spatial resolution can be considered as adequate resources to crop mapping. Especially, multitemporal vegetation indices (VI) studies have been currently used to realize this task [1] [2]. In this study, 16-days compositions of EVI (MODQ13 product) data are used. However, although these data are already processed, multitemporal VI profiles still remain noisy due to cloudiness (which is extremely frequent in a tropical region such as south Amazon Basin), sensor problems, errors in atmospheric corrections or BRDF effect. Thus, many works tried to develop algorithms that could smooth the multitemporal VI profiles in order to improve further classification. The goal of this study is to compare and test different smoothing algorithms in order to select the one which satisfies better to the demand which is classifying crop classes. Those classes correspond to 6 different agricultural managements observed in Mato Grosso through an intensive field work which resulted in mapping more than 1000 individual fields. The agricultural managements above mentioned are based on combination of soy, cotton, corn, millet and sorghum crops sowed in single or double crop systems. Due to the difficulty in separating certain classes because of too similar agricultural calendars, the classification will be reduced to 3 classes : Cotton (single crop), Soy and cotton (double crop), soy (single or double crop with corn, millet or sorghum). The classification will use training data obtained in the 2005-2006 harvest and then be tested on the 2006-2007 harvest. In a first step, four smoothing techniques are presented and criticized. Those techniques are Best Index Slope Extraction (BISE) [3], Mean Value Iteration (MVI) [4], Weighted Least Squares (WLS) [5] and Savitzky-Golay Filter (SG) [6] [7]. These techniques are then implemented and visually compared on a few individual pixels so that it allows doing a first selection between the five studied techniques. The WLS and SG techniques are selected according to criteria proposed by [8]. Those criteria are: ability in eliminating frequent noises, conserving the upper values of the VI profiles and keeping the temporality of the profiles. Those selected algorithms are then programmed and applied to the MODIS/TERRA EVI data (16-days composition periods). Tests of separability are realized based on the Jeffries-Matusita distance in order to see if the algorithms managed in improving the potential of differentiation between the classes. Those tests are realized on the overall profile (comprising 23 MODIS images) as well as on each MODIS sub-period of the profile [1]. This last test is a double interest process because it allows comparing the smoothing techniques and also enables to select a set of images which carries more information on the separability between the classes. Those selected dates can then be used to realize a supervised classification. Here three different classifiers are tested to evaluate if the smoothing techniques as a particular effect on the classification depending on the classifiers used. Those classifiers are Maximum Likelihood classifier, Spectral Angle Mapper (SAM) classifier and CHAID Improved Decision tree. It appears through the separability tests on the overall process that the smoothed profiles don't improve efficiently the potential of discrimination between classes when compared with the original data. However, the same tests realized on the MODIS sub-periods show better results obtained with the smoothed algorithms. The results of the classification confirm this first analyze. The Kappa coefficients are always better with the smoothing techniques and the results obtained with the WLS and SG smoothed profiles are nearly equal. However, the results are different depending on the classifier used. The impact of the smoothing algorithms is much better while using the decision tree model. Indeed, it allows a gain of 0.1 in the Kappa coefficient. While using the Maximum Likelihood end SAM models, the gain remains positive but is much lower (Kappa improved of 0.02 only). Thus, this work's aim is to prove the utility in smoothing the VI profiles in order to improve the final results. However, the choice of the smoothing algorithm has to be made considering the original data used and the classifier models used. In that case the Savitzky-Golay filter gave the better results.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

To assess binocular detection grating acuity using the LEA GRATINGS test to establish age-related norms in healthy infants during their first 3 months of life. In this prospective, longitudinal study of healthy infants with clear red reflex at birth, responses to gratings were measured at 1, 2, and 3 months of age using LEA gratings at a distance of 28 cm. The results were recorded as detection grating acuity values, which were arranged in frequency tables and converted to a one-octave scale for statistical analysis. For the repeated measurements, analysis of variance (ANOVA) was used to compare the detection grating acuity results between ages. A total of 133 infants were included. The binocular responses to gratings showed development toward higher mean values and spatial frequencies, ranging from 0.55 ± 0.70 cycles per degree (cpd), or 1.74 ± 0.21 logMAR, in month 1 to 3.11 ± 0.54 cpd, or 0.98 ± 0.16 logMAR, in month 3. Repeated ANOVA indicated differences among grating acuity values in the three age groups. The LEA GRATINGS test allowed assessment of detection grating acuity and its development in a cohort of healthy infants during their first 3 months of life.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A novel capillary electrophoresis method using capacitively coupled contactless conductivity detection is proposed for the determination of the biocide tetrakis(hydroxymethyl)phosphonium sulfate. The feasibility of the electrophoretic separation of this biocide was attributed to the formation of an anionic complex between the biocide and borate ions in the background electrolyte. Evidence of this complex formation was provided by (11) B NMR spectroscopy. A linear relationship (R(2) = 0.9990) between the peak area of the complex and the biocide concentration (50-900 μmol/L) was found. The limit of detection and limit of quantification were 15.0 and 50.1 μmol/L, respectively. The proposed method was applied to the determination of tetrakis(hydroxymethyl)phosphonium sulfate in commercial formulations, and the results were in good agreement with those obtained by the standard iodometric titration method. The method was also evaluated for the analysis of tap water and cooling water samples treated with the biocide. The results of the recovery tests at three concentration levels (300, 400, and 600 μmol/L) varied from 75 to 99%, with a relative standard deviation no higher than 9%.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Infections of the central nervous systems (CNS) present a diagnostic problem for which an accurate laboratory diagnosis is essential. Invasive practices, such as cerebral biopsy, have been replaced by obtaining a polymerase chain reaction (PCR) diagnosis using cerebral spinal fluid (CSF) as a reference method. Tests on DNA extracted from plasma are noninvasive, thus avoiding all of the collateral effects and patient risks associated with CSF collection. This study aimed to determine whether plasma can replace CSF in nested PCR analysis for the detection of CNS human herpesvirus (HHV) diseases by analysing the proportion of patients whose CSF nested PCR results were positive for CNS HHV who also had the same organism identified by plasma nested PCR. In this study, CSF DNA was used as the gold standard, and nested PCR was performed on both types of samples. Fifty-two patients with symptoms of nervous system infection were submitted to CSF and blood collection. For the eight HHV, one positive DNA result-in plasma and/or CSF nested PCR-was considered an active HHV infection, whereas the occurrence of two or more HHVs in the same sample was considered a coinfection. HHV infections were positively detected in 27/52 (51.9%) of the CSF and in 32/52 (61.5%) of the plasma, difference not significant, thus nested PCR can be performed on plasma instead of CSF. In conclusion, this findings suggest that plasma as a useful material for the diagnosis of cases where there is any difficulty to perform a CSF puncture.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The aim of this study was to develop a methodology using Raman hyperspectral imaging and chemometric methods for identification of pre- and post-blast explosive residues on banknote surfaces. The explosives studied were of military, commercial and propellant uses. After the acquisition of the hyperspectral imaging, independent component analysis (ICA) was applied to extract the pure spectra and the distribution of the corresponding image constituents. The performance of the methodology was evaluated by the explained variance and the lack of fit of the models, by comparing the ICA recovered spectra with the reference spectra using correlation coefficients and by the presence of rotational ambiguity in the ICA solutions. The methodology was applied to forensic samples to solve an automated teller machine explosion case. Independent component analysis proved to be a suitable method of resolving curves, achieving equivalent performance with the multivariate curve resolution with alternating least squares (MCR-ALS) method. At low concentrations, MCR-ALS presents some limitations, as it did not provide the correct solution. The detection limit of the methodology presented in this study was 50μgcm(-2).

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A rapid and low cost method to determine Cr(VI) in soils based upon alkaline metal extraction at room temperature is proposed as a semi-quantitative procedure to be performed in the field. A color comparison with standards with contents of Cr(VI) in the range of 10 to 150 mg kg-1 was used throughout. For the different types of soils studied, more than 75% of the fortified soluble Cr(VI) were recovered for all levels of spike tested for both the proposed and standard methods. Recoveries of 83 and 99% were obtained for the proposed and the standard methods, respectively, taking into account the analysis of a heavily contaminated soil sample.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Previous studies indicated that patients with atherosclerosis are predominantly infected by human cytomegalovirus (HCMV), but rarely infected by type 1 Epstein-Barr virus (EBV-1). In this study, atheromas of 30 patients who underwent aortocoronary bypass surgery with coronary endartherectomy were tested for the presence of these two viruses. HCMV occurred in 93.3% of the samples and EBV-1 was present in 50% of them. Concurrent presence of both pathogens was detected in 43.3% of the samples.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Secondary caries has been reported as the main reason for restoration replacement. The aim of this in vitro study was to evaluate the performance of different methods - visual inspection, laser fluorescence (DIAGNOdent), radiography and tactile examination - for secondary caries detection in primary molars restored with amalgam. Fifty-four primary molars were photographed and 73 suspect sites adjacent to amalgam restorations were selected. Two examiners evaluated independently these sites using all methods. Agreement between examiners was assessed by the Kappa test. To validate the methods, a caries-detector dye was used after restoration removal. The best cut-off points for the sample were found by a Receiver Operator Characteristic (ROC) analysis, and the area under the ROC curve (Az), and the sensitivity, specificity and accuracy of the methods were calculated for enamel (D2) and dentine (D3) thresholds. These parameters were found for each method and then compared by the McNemar test. The tactile examination and visual inspection presented the highest inter-examiner agreement for the D2 and D3 thresholds, respectively. The visual inspection also showed better performance than the other methods for both thresholds (Az = 0.861 and Az = 0.841, respectively). In conclusion, the visual inspection presented the best performance for detecting enamel and dentin secondary caries in primary teeth restored with amalgam.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

To determine the presence of Brucella ovis in ovine from Paraíba State, in the Northeast region of Brazil, 80 animals slaughtered in the public slaughterhouse of Patos city were used. Before slaughter, blood samples were collected by jugular venopuncture from each animal, and after slaughter, testicles, epidydimus and uterus were aseptically collected. For the serological diagnosis of B. ovis and B. abortus infections, the agar gel immunodiffusion (AGID) and Rose Bengal (RBT) tests were carried out, respectively. In addition, microbiological culture and polymerase chain reaction (PCR) were performed on testicle, epidydimus and uterus samples. Six animals (7.5%) tested positive for the presence of B. ovis antibodies and all animals tested negative for the presence of B. abortus antibodies. One AGID-positive animal tested positive at uterine swab culture. PCR was able to amplify DNA of Brucella spp. from the pool of testicle, epidydimus and uterus samples from AGID-positive animals. This is the first report of isolation and detection of B. ovis DNA by PCR in ovine from the Northeast region of Brazil.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The objective of the present study was to improve the detection of B. abortus by PCR in organs of aborted fetuses from infected cows, an important mechanism to find infected herds on the eradication phase of the program. So, different DNA extraction protocols were compared, focusing the PCR detection of B. abortus in clinical samples collected from aborted fetuses or calves born from cows challenged with the 2308 B. abortus strain. Therefore, two gold standard groups were built based on classical bacteriology, formed from: 32 lungs (17 positives), 26 spleens (11 positives), 23 livers (8 positives) and 22 bronchial lymph nodes (7 positives). All samples were submitted to three DNA extraction protocols, followed by the same amplification process with the primers B4 and B5. From the accumulated results for organ, the proportion of positives for the lungs was higher than the livers (p=0.04) or bronchial lymph nodes (p=0.004) and equal to the spleens (p=0.18). From the accumulated results for DNA extraction protocol, the proportion of positives for the Boom protocol was bigger than the PK (p<0.0001) and GT (p=0.0004). There was no difference between the PK and GT protocols (p=0.5). Some positive samples from the classical bacteriology were negative to the PCR and viceversa. Therefore, the best strategy for B. abortus detection in the organs of aborted fetuses or calves born from infected cows is the use, in parallel, of isolation by classical bacteriology and the PCR, with the DNA extraction performed by the Boom protocol.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The quantification of the available energy in the environment is important because it determines photosynthesis, evapotranspiration and, therefore, the final yield of crops. Instruments for measuring the energy balance are costly and indirect estimation alternatives are desirable. This study assessed the Deardorff's model performance during a cycle of a sugarcane crop in Piracicaba, State of São Paulo, Brazil, in comparison to the aerodynamic method. This mechanistic model simulates the energy fluxes (sensible, latent heat and net radiation) at three levels (atmosphere, canopy and soil) using only air temperature, relative humidity and wind speed measured at a reference level above the canopy, crop leaf area index, and some pre-calibrated parameters (canopy albedo, soil emissivity, atmospheric transmissivity and hydrological characteristics of the soil). The analysis was made for different time scales, insolation conditions and seasons (spring, summer and autumn). Analyzing all data of 15 minute intervals, the model presented good performance for net radiation simulation in different insolations and seasons. The latent heat flux in the atmosphere and the sensible heat flux in the atmosphere did not present differences in comparison to data from the aerodynamic method during the autumn. The sensible heat flux in the soil was poorly simulated by the model due to the poor performance of the soil water balance method. The Deardorff's model improved in general the flux simulations in comparison to the aerodynamic method when more insolation was available in the environment.