Appendix A. Whole-rock major, trace and rare earth element analyses of the Ulubey volcanics, Appendix B. Analytical standards and detection limits for analyses

Collisional and post-collisional volcanic rocks in the Ulubey (Ordu) area at the western edge of the Eastern Pontide Tertiary Volcanic Province (EPTVP) in NE Turkey are divided into four suites; Middle Eocene (49.4-44.6 Ma) aged Andesite-Trachyandesite (AT), Trachyandesite-Trachydacite-Rhyolite (TTR), Trachydacite-Dacite (TD) suites, and Middle Miocene (15.1 Ma) aged Trachybasalt (TB) suite. Local stratigraphy in the Ulubey area starts with shallow marine environment sediments of the Paleocene-Eocene time and then continues extensively with sub-aerial andesitic to rhyolitic and rare basaltic volcanism during Eocene and Miocene time, respectively. Petrographically, the volcanic rocks are composed primarily of andesites/trachyandesites, with minor trachydacites/rhyolites, basalts/trachybasalts and pyroclastics, and show porphyric, hyalo-microlitic porphyric and rarely glomeroporphyric, intersertal, intergranular, fluidal and sieve textures. The Ulubey (Ordu) volcanic rocks indicate magma evolution from tholeiitic-alkaline to calc-alkaline with medium-K contents. Primitive mantle normalized trace element and chondrite normalized rare earth element (REE) patterns show that the volcanic rocks have moderate light rare earth element (LREE)/heavy rare earth element (HREE) ratios relative to E-Type MORB and depletion in Nb, Ta and Ti. High Th/Yb ratios indicate parental magma(s) derived from an enriched source formed by mixing of slab and asthenospheric melts previously modified by fluids and sediments from a subduction zone. All of the volcanic rocks share similar incompatible element ratios (e.g., La/Sm, Zr/Nb, La/Nb) and chondrite-normalized REE patterns, indicating that the basic to acidic rocks originated from the same source. The volcanic rocks were produced by the slab dehydration-induced melting of an existing metasomatized mantle source, and the fluids from the slab dehydration introduced significant large ion lithophile element (LILE) and LREE to the source, masking its inherent HFSE-enriched characteristics. The initial 87Sr/86Sr (0.7044-0.7050) and eNd (-0.3 to +3.4) ratios of the volcanics suggest that they originated from an enriched lithospheric mantle source with low Sm/Nd ratios. Integration of the geochemical, petrological and isotopical with regional and local geological data suggest that the Tertiary volcanic rocks from the Ulubey (Ordu) area were derived from an enriched mantle, which had been previously metasomatized by fluids derived from subducted slab during Eocene to Miocene in collisional and post-collisional extension-related geodynamic setting following Late Mesozoic continental collision between the Eurasian plate and the Tauride-Anatolide platform.

Vision-based vehicle detection and tracking with a mobile camera using a statistical framework

En esta tesis se aborda la detección y el seguimiento automático de vehículos mediante técnicas de visión artificial con una cámara monocular embarcada. Este problema ha suscitado un gran interés por parte de la industria automovilística y de la comunidad científica ya que supone el primer paso en aras de la ayuda a la conducción, la prevención de accidentes y, en última instancia, la conducción automática. A pesar de que se le ha dedicado mucho esfuerzo en los últimos años, de momento no se ha encontrado ninguna solución completamente satisfactoria y por lo tanto continúa siendo un tema de investigación abierto. Los principales problemas que plantean la detección y seguimiento mediante visión artificial son la gran variabilidad entre vehículos, un fondo que cambia dinámicamente debido al movimiento de la cámara, y la necesidad de operar en tiempo real. En este contexto, esta tesis propone un marco unificado para la detección y seguimiento de vehículos que afronta los problemas descritos mediante un enfoque estadístico. El marco se compone de tres grandes bloques, i.e., generación de hipótesis, verificación de hipótesis, y seguimiento de vehículos, que se llevan a cabo de manera secuencial. No obstante, se potencia el intercambio de información entre los diferentes bloques con objeto de obtener el máximo grado posible de adaptación a cambios en el entorno y de reducir el coste computacional. Para abordar la primera tarea de generación de hipótesis, se proponen dos métodos complementarios basados respectivamente en el análisis de la apariencia y la geometría de la escena. Para ello resulta especialmente interesante el uso de un dominio transformado en el que se elimina la perspectiva de la imagen original, puesto que este dominio permite una búsqueda rápida dentro de la imagen y por tanto una generación eficiente de hipótesis de localización de los vehículos. Los candidatos finales se obtienen por medio de un marco colaborativo entre el dominio original y el dominio transformado. Para la verificación de hipótesis se adopta un método de aprendizaje supervisado. Así, se evalúan algunos de los métodos de extracción de características más populares y se proponen nuevos descriptores con arreglo al conocimiento de la apariencia de los vehículos. Para evaluar la efectividad en la tarea de clasificación de estos descriptores, y dado que no existen bases de datos públicas que se adapten al problema descrito, se ha generado una nueva base de datos sobre la que se han realizado pruebas masivas. Finalmente, se presenta una metodología para la fusión de los diferentes clasificadores y se plantea una discusión sobre las combinaciones que ofrecen los mejores resultados. El núcleo del marco propuesto está constituido por un método Bayesiano de seguimiento basado en filtros de partículas. Se plantean contribuciones en los tres elementos fundamentales de estos filtros: el algoritmo de inferencia, el modelo dinámico y el modelo de observación. En concreto, se propone el uso de un método de muestreo basado en MCMC que evita el elevado coste computacional de los filtros de partículas tradicionales y por consiguiente permite que el modelado conjunto de múltiples vehículos sea computacionalmente viable. Por otra parte, el dominio transformado mencionado anteriormente permite la definición de un modelo dinámico de velocidad constante ya que se preserva el movimiento suave de los vehículos en autopistas. Por último, se propone un modelo de observación que integra diferentes características. En particular, además de la apariencia de los vehículos, el modelo tiene en cuenta también toda la información recibida de los bloques de procesamiento previos. El método propuesto se ejecuta en tiempo real en un ordenador de propósito general y da unos resultados sobresalientes en comparación con los métodos tradicionales. ABSTRACT This thesis addresses on-road vehicle detection and tracking with a monocular vision system. This problem has attracted the attention of the automotive industry and the research community as it is the first step for driver assistance and collision avoidance systems and for eventual autonomous driving. Although many effort has been devoted to address it in recent years, no satisfactory solution has yet been devised and thus it is an active research issue. The main challenges for vision-based vehicle detection and tracking are the high variability among vehicles, the dynamically changing background due to camera motion and the real-time processing requirement. In this thesis, a unified approach using statistical methods is presented for vehicle detection and tracking that tackles these issues. The approach is divided into three primary tasks, i.e., vehicle hypothesis generation, hypothesis verification, and vehicle tracking, which are performed sequentially. Nevertheless, the exchange of information between processing blocks is fostered so that the maximum degree of adaptation to changes in the environment can be achieved and the computational cost is alleviated. Two complementary strategies are proposed to address the first task, i.e., hypothesis generation, based respectively on appearance and geometry analysis. To this end, the use of a rectified domain in which the perspective is removed from the original image is especially interesting, as it allows for fast image scanning and coarse hypothesis generation. The final vehicle candidates are produced using a collaborative framework between the original and the rectified domains. A supervised classification strategy is adopted for the verification of the hypothesized vehicle locations. In particular, state-of-the-art methods for feature extraction are evaluated and new descriptors are proposed by exploiting the knowledge on vehicle appearance. Due to the lack of appropriate public databases, a new database is generated and the classification performance of the descriptors is extensively tested on it. Finally, a methodology for the fusion of the different classifiers is presented and the best combinations are discussed. The core of the proposed approach is a Bayesian tracking framework using particle filters. Contributions are made on its three key elements: the inference algorithm, the dynamic model and the observation model. In particular, the use of a Markov chain Monte Carlo method is proposed for sampling, which circumvents the exponential complexity increase of traditional particle filters thus making joint multiple vehicle tracking affordable. On the other hand, the aforementioned rectified domain allows for the definition of a constant-velocity dynamic model since it preserves the smooth motion of vehicles in highways. Finally, a multiple-cue observation model is proposed that not only accounts for vehicle appearance but also integrates the available information from the analysis in the previous blocks. The proposed approach is proven to run near real-time in a general purpose PC and to deliver outstanding results compared to traditional methods.

Evaluation of the multi-element capabilities of collision/reaction cell inductively coupled plasma - mass spectrometry in wine analysis

This work explores the multi-element capabilities of inductively coupled plasma - mass spectrometry with collision/reaction cell technology (CCT-ICP-MS) for the simultaneous determination of both spectrally interfered and non-interfered nuclides in wine samples using a single set of experimental conditions. The influence of the cell gas type (i.e. He, He+H2 and He+NH3), cell gas flow rate and sample pre-treatment (i.e. water dilution or acid digestion) on the background-equivalent concentration (BEC) of several nuclides covering the mass range from 7 to 238 u has been studied. Results obtained in this work show that, operating the collision/reaction cell with a compromise cell gas flow rate (i.e. 4 mL min−1) improves BEC values for interfered nuclides without a significant effect on the BECs for non-interfered nuclides, with the exception of the light elements Li and Be. Among the different cell gas mixtures tested, the use of He or He+H2 is preferred over He+NH3 because NH3 generates new spectral interferences. No significant influence of the sample pre-treatment methodology (i.e. dilution or digestion) on the multi-element capabilities of CCT-ICP-MS in the context of simultaneous analysis of interfered and non-interfered nuclides was observed. Nonetheless, sample dilution should be kept at minimum to ensure that light nuclides (e.g. Li and Be) could be quantified in wine. Finally, a direct 5-fold aqueous dilution is recommended for the simultaneous trace and ultra-trace determination of spectrally interfered and non-interfered elements in wine by means of CCT-ICP-MS. The use of the CCT is mandatory for interference-free ultra-trace determination of Ti and Cr. Only Be could not be determined when using the CCT due to a deteriorated limit of detection when compared to conventional ICP-MS.

Assessment of IVHS countermeasures for collision avoidance: rear-end crashes.

Mode of access: Internet.

Multisensorial obstacles detection and classification for ADAS and autonomous driving

A reliable perception of the real world is a key-feature for an autonomous vehicle and the Advanced Driver Assistance Systems (ADAS). Obstacles detection (OD) is one of the main components for the correct reconstruction of the dynamic world. Historical approaches based on stereo vision and other 3D perception technologies (e.g. LIDAR) have been adapted to the ADAS first and autonomous ground vehicles, after, providing excellent results. The obstacles detection is a very broad field and this domain counts a lot of works in the last years. In academic research, it has been clearly established the essential role of these systems to realize active safety systems for accident prevention, reflecting also the innovative systems introduced by industry. These systems need to accurately assess situational criticalities and simultaneously assess awareness of these criticalities by the driver; it requires that the obstacles detection algorithms must be reliable and accurate, providing: a real-time output, a stable and robust representation of the environment and an estimation independent from lighting and weather conditions. Initial systems relied on only one exteroceptive sensor (e.g. radar or laser for ACC and camera for LDW) in addition to proprioceptive sensors such as wheel speed and yaw rate sensors. But, current systems, such as ACC operating at the entire speed range or autonomous braking for collision avoidance, require the use of multiple sensors since individually they can not meet these requirements. It has led the community to move towards the use of a combination of them in order to exploit the benefits of each one. Pedestrians and vehicles detection are ones of the major thrusts in situational criticalities assessment, still remaining an active area of research. ADASs are the most prominent use case of pedestrians and vehicles detection. Vehicles should be equipped with sensing capabilities able to detect and act on objects in dangerous situations, where the driver would not be able to avoid a collision. A full ADAS or autonomous vehicle, with regard to pedestrians and vehicles, would not only include detection but also tracking, orientation, intent analysis, and collision prediction. The system detects obstacles using a probabilistic occupancy grid built from a multi-resolution disparity map. Obstacles classification is based on an AdaBoost SoftCascade trained on Aggregate Channel Features. A final stage of tracking and fusion guarantees stability and robustness to the result.

The Lea Grating Test In Assessing Detection Grating Acuity In Normal Infants Less Than 4 Months Of Age.

To assess binocular detection grating acuity using the LEA GRATINGS test to establish age-related norms in healthy infants during their first 3 months of life. In this prospective, longitudinal study of healthy infants with clear red reflex at birth, responses to gratings were measured at 1, 2, and 3 months of age using LEA gratings at a distance of 28 cm. The results were recorded as detection grating acuity values, which were arranged in frequency tables and converted to a one-octave scale for statistical analysis. For the repeated measurements, analysis of variance (ANOVA) was used to compare the detection grating acuity results between ages. A total of 133 infants were included. The binocular responses to gratings showed development toward higher mean values and spatial frequencies, ranging from 0.55 ± 0.70 cycles per degree (cpd), or 1.74 ± 0.21 logMAR, in month 1 to 3.11 ± 0.54 cpd, or 0.98 ± 0.16 logMAR, in month 3. Repeated ANOVA indicated differences among grating acuity values in the three age groups. The LEA GRATINGS test allowed assessment of detection grating acuity and its development in a cohort of healthy infants during their first 3 months of life.

Determination Of Tetrakis(hydroxymethyl)phosphonium Sulfate In Commercial Formulations And Cooling Water By Capillary Electrophoresis With Contactless Conductivity Detection.

A novel capillary electrophoresis method using capacitively coupled contactless conductivity detection is proposed for the determination of the biocide tetrakis(hydroxymethyl)phosphonium sulfate. The feasibility of the electrophoretic separation of this biocide was attributed to the formation of an anionic complex between the biocide and borate ions in the background electrolyte. Evidence of this complex formation was provided by (11) B NMR spectroscopy. A linear relationship (R(2) = 0.9990) between the peak area of the complex and the biocide concentration (50-900 μmol/L) was found. The limit of detection and limit of quantification were 15.0 and 50.1 μmol/L, respectively. The proposed method was applied to the determination of tetrakis(hydroxymethyl)phosphonium sulfate in commercial formulations, and the results were in good agreement with those obtained by the standard iodometric titration method. The method was also evaluated for the analysis of tap water and cooling water samples treated with the biocide. The results of the recovery tests at three concentration levels (300, 400, and 600 μmol/L) varied from 75 to 99%, with a relative standard deviation no higher than 9%.

Human Herpesvirus Infections Of The Central Nervous System: Laboratory Diagnosis Based On Dna Detection By Nested Pcr In Plasma And Cerebrospinal Fluid Samples.

Infections of the central nervous systems (CNS) present a diagnostic problem for which an accurate laboratory diagnosis is essential. Invasive practices, such as cerebral biopsy, have been replaced by obtaining a polymerase chain reaction (PCR) diagnosis using cerebral spinal fluid (CSF) as a reference method. Tests on DNA extracted from plasma are noninvasive, thus avoiding all of the collateral effects and patient risks associated with CSF collection. This study aimed to determine whether plasma can replace CSF in nested PCR analysis for the detection of CNS human herpesvirus (HHV) diseases by analysing the proportion of patients whose CSF nested PCR results were positive for CNS HHV who also had the same organism identified by plasma nested PCR. In this study, CSF DNA was used as the gold standard, and nested PCR was performed on both types of samples. Fifty-two patients with symptoms of nervous system infection were submitted to CSF and blood collection. For the eight HHV, one positive DNA result-in plasma and/or CSF nested PCR-was considered an active HHV infection, whereas the occurrence of two or more HHVs in the same sample was considered a coinfection. HHV infections were positively detected in 27/52 (51.9%) of the CSF and in 32/52 (61.5%) of the plasma, difference not significant, thus nested PCR can be performed on plasma instead of CSF. In conclusion, this findings suggest that plasma as a useful material for the diagnosis of cases where there is any difficulty to perform a CSF puncture.

Detection Of Explosives On The Surface Of Banknotes By Raman Hyperspectral Imaging And Independent Component Analysis.

The aim of this study was to develop a methodology using Raman hyperspectral imaging and chemometric methods for identification of pre- and post-blast explosive residues on banknote surfaces. The explosives studied were of military, commercial and propellant uses. After the acquisition of the hyperspectral imaging, independent component analysis (ICA) was applied to extract the pure spectra and the distribution of the corresponding image constituents. The performance of the methodology was evaluated by the explained variance and the lack of fit of the models, by comparing the ICA recovered spectra with the reference spectra using correlation coefficients and by the presence of rotational ambiguity in the ICA solutions. The methodology was applied to forensic samples to solve an automated teller machine explosion case. Independent component analysis proved to be a suitable method of resolving curves, achieving equivalent performance with the multivariate curve resolution with alternating least squares (MCR-ALS) method. At low concentrations, MCR-ALS presents some limitations, as it did not provide the correct solution. The detection limit of the methodology presented in this study was 50μgcm(-2).

A screening method for detection of hexavalent chromium levels in soils

A rapid and low cost method to determine Cr(VI) in soils based upon alkaline metal extraction at room temperature is proposed as a semi-quantitative procedure to be performed in the field. A color comparison with standards with contents of Cr(VI) in the range of 10 to 150 mg kg-1 was used throughout. For the different types of soils studied, more than 75% of the fortified soluble Cr(VI) were recovered for all levels of spike tested for both the proposed and standard methods. Recoveries of 83 and 99% were obtained for the proposed and the standard methods, respectively, taking into account the analysis of a heavily contaminated soil sample.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Detection of human cytomegalovirus and Epstein-Barr virus in coronary atherosclerotic tissue

Previous studies indicated that patients with atherosclerosis are predominantly infected by human cytomegalovirus (HCMV), but rarely infected by type 1 Epstein-Barr virus (EBV-1). In this study, atheromas of 30 patients who underwent aortocoronary bypass surgery with coronary endartherectomy were tested for the presence of these two viruses. HCMV occurred in 93.3% of the samples and EBV-1 was present in 50% of them. Concurrent presence of both pathogens was detected in 43.3% of the samples.

Validity and reliability of methods for the detection of secondary caries around amalgam restorations in primary teeth

Secondary caries has been reported as the main reason for restoration replacement. The aim of this in vitro study was to evaluate the performance of different methods - visual inspection, laser fluorescence (DIAGNOdent), radiography and tactile examination - for secondary caries detection in primary molars restored with amalgam. Fifty-four primary molars were photographed and 73 suspect sites adjacent to amalgam restorations were selected. Two examiners evaluated independently these sites using all methods. Agreement between examiners was assessed by the Kappa test. To validate the methods, a caries-detector dye was used after restoration removal. The best cut-off points for the sample were found by a Receiver Operator Characteristic (ROC) analysis, and the area under the ROC curve (Az), and the sensitivity, specificity and accuracy of the methods were calculated for enamel (D2) and dentine (D3) thresholds. These parameters were found for each method and then compared by the McNemar test. The tactile examination and visual inspection presented the highest inter-examiner agreement for the D2 and D3 thresholds, respectively. The visual inspection also showed better performance than the other methods for both thresholds (Az = 0.861 and Az = 0.841, respectively). In conclusion, the visual inspection presented the best performance for detecting enamel and dentin secondary caries in primary teeth restored with amalgam.

Spatial pattern detection modeling of thrips (Thrips tabaci) on onion fields

Onion (Allium cepa) is one of the most cultivated and consumed vegetables in Brazil and its importance is due to the large laborforce involved. One of the main pests that affect this crop is the Onion Thrips (Thrips tabaci), but the spatial distribution of this insect, although important, has not been considered in crop management recommendations, experimental planning or sampling procedures. Our purpose here is to consider statistical tools to detect and model spatial patterns of the occurrence of the onion thrips. In order to characterize the spatial distribution pattern of the Onion Thrips a survey was carried out to record the number of insects in each development phase on onion plant leaves, on different dates and sample locations, in four rural properties with neighboring farms under different infestation levels and planting methods. The Mantel randomization test proved to be a useful tool to test for spatial correlation which, when detected, was described by a mixed spatial Poisson model with a geostatistical random component and parameters allowing for a characterization of the spatial pattern, as well as the production of prediction maps of susceptibility to levels of infestation throughout the area.

Detection of Brucella ovis in ovine from Paraíba State, in the Northeast region of Brazil

To determine the presence of Brucella ovis in ovine from Paraíba State, in the Northeast region of Brazil, 80 animals slaughtered in the public slaughterhouse of Patos city were used. Before slaughter, blood samples were collected by jugular venopuncture from each animal, and after slaughter, testicles, epidydimus and uterus were aseptically collected. For the serological diagnosis of B. ovis and B. abortus infections, the agar gel immunodiffusion (AGID) and Rose Bengal (RBT) tests were carried out, respectively. In addition, microbiological culture and polymerase chain reaction (PCR) were performed on testicle, epidydimus and uterus samples. Six animals (7.5%) tested positive for the presence of B. ovis antibodies and all animals tested negative for the presence of B. abortus antibodies. One AGID-positive animal tested positive at uterine swab culture. PCR was able to amplify DNA of Brucella spp. from the pool of testicle, epidydimus and uterus samples from AGID-positive animals. This is the first report of isolation and detection of B. ovis DNA by PCR in ovine from the Northeast region of Brazil.