Male reproductive success and multiple paternity in wild, low-density populations of the adder (Vipera berus).

We studied for the first time the occurrence of multiple paternity, male reproductive success, and neonate survival in wild, low-density adder (Vipera berus) populations using 13 microsatellite loci. Paternity was assigned for 15 clutches, collected during 3 years. Our data demonstrated that multiple paternity can occur at a high level (69%) in natural populations of V. berus, even if the density of adults is low. The high proportion of multiple sired clutches was comparable to the proportion observed in captive populations. Male reproductive success significantly increased with body length, and only the largest males successfully sired entire clutches. Finally, no relationship was detected between the number of fathers per clutch and neonate survival. These results suggest that multiple matings could be beneficial in populations with high level of inbreeding or low male fecundity.

Fathers of girls, fathers of boys: influence of child's gender on fathers' experience of, engagement in, and representations of paternity.

The aim of this study was to examine the influence of child's gender on several dimensions-of paternity: the fathers' personal experience of paternity, their involvement in child rearing, and their representations. A total of 147 Swiss fathers of 18-month-old children (65 girls and 82 boys) relationship to the child or relationship with the child's completed questionnaires. The child's gender had little influence on paternal experience, mother. Globally, the fathers took on few responsibilities which were largely devolved to mothers. Fathers of boys were more involved in child care than fathers of girls. Finally, a discrepancy was found between the fathers representations of paternal roles in rearing girls and boys and the actual level of responsibility that fathers adopted in their relationship with their child.

Altruism, uncertain lifetime and the distribution of wealth

This paper studies the dynamics of the distribution of wealth in ageneral equilibrium framework. It considers an overlapping generationsmodel with production and altruistic preferences in which individualsface an uncertain lifetime and annuity markets do not exist. Thispaper focuses on the role that accidental bequests, voluntary bequests,and non--negativity constraints on bequests play in the dynamics of thedistribution of wealth. It is proved that the equilibrium interestrate is lower than the one that satisfies the modified goldenrule. In this economy, a social security system not only plays aninsurance role, but also prevents capital overaccumulation. In fact,this paper shows that a pay--as--you--go social security systemdecentralizes the social planner solution as a competitive equilibrium.

Effects of uncertain lifetime and annuity insurance on capital accumulation and growth

This paper studies the effects of uncertain lifetime on capitalaccumulation and growth and also the sensitivity of thoseeffects to the existence of a perfect annuities market. Themodel is an overlapping generations model with uncertainlifetimes. The technology is convex and such that the marginalproduct of capital is bounded away from zero. A contribution ofthis paper is to show that the existence of accidental bequestsmay lead the economy to an equilibrium that exhibits asymptoticgrowth, which is impossible in an economy with a perfect annuitiesmarket or with certain lifetimes. This paper also shows that ifindividuals face a positive probability of surviving in everyperiod, they may be willing to save at any age. This effect ofuncertain lifetime on savings may also lead the economy to anequilibrium exhibiting asymptotic growth even if there exists aperfect annuities market.

Intergenerational justice when future worlds are uncertain

Let there be a positive (exogenous) probability that, at each date, the human species will disappear.We postulate an Ethical Observer (EO) who maximizes intertemporal welfare under thisuncertainty, with expected-utility preferences. Various social welfare criteria entail alternativevon Neumann- Morgenstern utility functions for the EO: utilitarian, Rawlsian, and an extensionof the latter that corrects for the size of population. Our analysis covers, first, a cake-eating economy(without production), where the utilitarian and Rawlsian recommend the same allocation.Second, a productive economy with education and capital, where it turns out that the recommendationsof the two EOs are in general different. But when the utilitarian program diverges, thenwe prove it is optimal for the extended Rawlsian to ignore the uncertainty concerning the possibledisappearance of the human species in the future. We conclude by discussing the implicationsfor intergenerational welfare maximization in the presence of global warming.

Decision making in uncertain and changing environments

We consider an agent who has to repeatedly make choices in an uncertainand changing environment, who has full information of the past, who discountsfuture payoffs, but who has no prior. We provide a learning algorithm thatperforms almost as well as the best of a given finite number of experts orbenchmark strategies and does so at any point in time, provided the agentis sufficiently patient. The key is to find the appropriate degree of forgettingdistant past. Standard learning algorithms that treat recent and distant pastequally do not have the sequential epsilon optimality property.

Multiple Paternity in Polyandrous Barn Owls (Tyto alba).

In polyandrous species females produce successive clutches with several males. Female barn owls (Tyto alba) often desert their offspring and mate to produce a 2(nd) annual brood with a second male. We tested whether copulating during chick rearing at the 1(st) annual brood increases the male's likelihood to obtain paternity at the 2(nd) annual breeding attempt of his female mate in case she deserts their brood to produce a second brood with a different male. Using molecular paternity analyses we found that 2 out of 26 (8%) second annual broods of deserting females contained in total 6 extra-pair young out of 15 nestlings. These young were all sired by the male with whom the female had produced the 1(st) annual brood. In contrast, none of the 49 1(st) annual breeding attempts (219 offspring) and of the 20 2(nd) annual breeding attempts (93 offspring) of non-deserting females contained extra-pair young. We suggest that female desertion can select male counter-strategies to increase paternity and hence individual fitness. Alternatively, females may copulate with the 1(st) male to derive genetic benefits, since he is usually of higher quality than the 2(nd) male which is commonly a yearling individual.

Cross-amplification of polymorphic microsatellites reveals extra-pair paternity and brood parasitism in Sturnus vulgaris

We tested the cross-amplification of 37 microsatellites in a population of starlings (Stumus vulgaris). Twenty-three of them amplified and five exhibited a large number of alleles per locus and high heterozygosity (on average: 14.6 alleles/locus and H. = 0.704). We assessed the occurrence of extra-pair paternity (EPP) and intraspecific brood parasitism GBP) in this population. The EPP rate was 16% to 18% offspring from 43% to 45% of nests. IBP was very variable between two successive years (14% to 27% chicks from 25% to 64% of clutches). These five polymorphic markers will be of potential use in studies of genetic diversity, population structure and reproductive strategy of this species.

Extra-pair paternity, testes size and testosterone level in relation to colour polymorphism in the barn owl Tyto alba

In many bird populations, individuals display one of several genetically inherited colour morphs. Colour polymorphism can be maintained by several mechanisms one of which being frequency-dependent selection with colour morphs signalling alternative mating strategies. One morph may be dominant and territorial, and another one adopt a sneaky behaviour to gain access to fertile females. We tested this hypothesis in the barn owl Tyto alba in which coloration varies from reddish-brown to white. This trait is heritable and neither sensitive to the environment in which individuals live nor to body condition. In Switzerland, reddish-brown males were observed to feed their brood at a higher rate and to produce more offspring than white males. This observation lead us to hypothesize that white males may equalise fitness by investing more effort in extra-pair copulations. This hypothesis predicts that lighter Coloured males produce more extra-pair young, have larger testes and higher levels of circulating testosterone. However, our results are not consistent with these three predictions. First, paternity analyses of 54 broods with a total of 211 offspring revealed that only one young was not sired by the male that was feeding it. Second, testes size was not correlated with male plumage coloration suggesting that white males are not sexually more active. Finally, in nestlings at the time of feather growth testosterone level was not related to plumage coloration suggesting that this androgen is not required for the expression of this plumage trait. Our study therefore indicates that in the barn owl colour polymorphism plays no role in the probability of producing extra-pair young.

Male reproductive success: paternity contribution to queens and workers in Formica ants

The relative number of workers and female sexuals fathered by two males mated with a queen were directly assessed using microsatellite and allozyme markers in field colonies of the ants Formica exsecta and F. truncorum. In both species one of the two males consistently fathered more offspring than the other. There was, however, no evidence that one male might be particularly successful in fathering a disproportionally high proportion of female sexuals relative to the proportion of workers. Moreover, in F. exsecta, the proportions of worker pupae and worker adults fathered by each male did not differ significantly between cohorts. The most likely explanation for this pattern is that females store different amounts of sperm from the two males they mated with.

Pacemaker therapy in patients with neurally mediated syncope and documented asystole: Third International Study on Syncope of Uncertain Etiology (ISSUE-3): a randomized trial.

BACKGROUND: The efficacy of cardiac pacing for prevention of syncopal recurrences in patients with neurally mediated syncope is controversial. We wanted to determine whether pacing therapy reduces syncopal recurrences in patients with severe asystolic neurally mediated syncope. METHODS AND RESULTS: Double-blind, randomized placebo-controlled study conducted in 29 centers in the Third International Study on Syncope of Uncertain Etiology (ISSUE-3) trial. Patients were ≥40 years, had experienced ≥3 syncopal episodes in the previous 2 years. Initially, 511 patients, received an implantable loop recorder; 89 of these had documentation of syncope with ≥3 s asystole or ≥6 s asystole without syncope within 12 ± 10 months and met criteria for pacemaker implantation; 77 of 89 patients were randomly assigned to dual-chamber pacing with rate drop response or to sensing only. The data were analyzed on intention-to-treat principle. There was syncope recurrence during follow-up in 27 patients, 19 of whom had been assigned to pacemaker OFF and 8 to pacemaker ON. The 2-year estimated syncope recurrence rate was 57% (95% CI, 40-74) with pacemaker OFF and 25% (95% CI, 13-45) with pacemaker ON (log rank: P=0.039 at the threshold of statistical significance of 0.04). The risk of recurrence was reduced by 57% (95% CI, 4-81). Five patients had procedural complications: lead dislodgment in 4 requiring correction and subclavian vein thrombosis in 1 patient. CONCLUSIONS: Dual-chamber permanent pacing is effective in reducing recurrence of syncope in patients ≥40 years with severe asystolic neurally mediated syncope. The observed 32% absolute and 57% relative reduction in syncope recurrence support this invasive treatment for the relatively benign neurally mediated syncope. CLINICAL TRIAL REGISTRATION: URL: http://www.clinicaltrials.gov. Unique identifier: NCT00359203.

Paternity test in "Mangalarga-Marchador" equines by DNA-fingerprinting

GC-rich molecular minisatellite probes isolated from the human genome have presented a poor ability for individualization in horses. In this study new DNA sequences were isolated which could be used in paternity tests in horses. Genomic DNA from "Mangalarga-Marchador" horses was treated with restriction enzymes that preferentially digest non-repetitive sequences, so preserving the structure where mini and microsatellites are located. Four clones (S01, S05, S07 and S09) selected from a genomic library screened with a (TG)n oligonucleotide showed similar hybridization profiles generating bands of DNA-fingerprinting type. Using these probes the individualization power obtained was 10-8, which is 10(5)fold higher than that obtained with M13, another GC-rich type probe. All clones were efficient in parentage detection in crossbreedings and presented a 27 bp consensus sequence, GTTTCATTTATTATTCTTTGGAAGAAA, which was repeated 12, 18, 11 and 21 times in clones S01, S05, S07 and S09, respectively.