959 resultados para UNIVERSAL PRIMERS


Relevância:

60.00% 60.00%

Publicador:

Resumo:

In Mesoamerica, tropical dry forest is a highly threatened habitat, and species endemic to this environment are under extreme pressure. The tree species, Lonchocarpus costaricensis is endemic to the dry northwest of Costa Rica and southwest Nicaragua. It is a locally important species but, as land has been cleared for agriculture, populations have experienced considerable reduction and fragmentation. To assess current levels and distribution of genetic diversity in the species, a combination of chloroplast-specific (cpDNA) and whole genome DNA markers (amplified fragment length polymorphism, AFLP) were used to fingerprint 121 individual trees in 6 populations. Two cpDNA haplotypes were identified, distributed among populations such that populations at the extremes of the distribution showed lowest diversity. A large number (487) of AFLP markers were obtained and indicated that diversity levels were highest in the two coastal populations (Cobano, Matapalo, H = 0.23, 0.28 respectively). Population differentiation was low overall, F-ST = 0.12, although Matapalo was strongly differentiated from all other populations (F-ST = 0.16-0.22), apart from Cobano (F., = 0.11). Spatial genetic structure was present in both datasets at different scales: cpDNA was structured at a range-wide distribution scale, whilst AFLP data revealed genetic neighbourhoods on a population scale. In general, the habitat degradation of recent times appears not to have yet impacted diversity levels in mature populations. However, although no data on seed or saplings were collected, it seems likely that reproductive mechanisms in the species will have been affected by land clearance. It is recommended that efforts should be made to conserve the extant genetic resource base and further research undertaken to investigate diversity levels in the progeny generation.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

Current methods of understanding microbiome composition and structure rely on accurately estimating the number of distinct species and their relative abundance. Most of these methods require an efficient PCR whose forward and reverse primers bind well to the same, large number of identifiable species, and produce amplicons that are unique. It is therefore not surprising that currently used universal primers designed many years ago are not as efficient and fail to bind to recently cataloged species. We propose an automated general method of designing PCR primer pairs that abide by primer design rules and uses current sequence database as input. Since the method is automated, primers can be designed for targeted microbial species or updated as species are added or deleted from the database. In silico experiments and laboratory experiments confirm the efficacy of the newly designed primers for metagenomics applications.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

With the increased antibiotic exposure from anthropogenic sources, soil microbes are an ever-increasing ecological pool of resistant bacteria. This is the case with bacterial resistance to vancomycin through transfer of van-resistance genes by transposons. Studies show that bacterial species other than enteroccoci harbor genetic-like elements such as the Tn1546 transposon containing vancomycin-resistant genes. Overuse and misuse of antibiotics in hospital settings and agricultural practices have led to an increase in transferability of vancomycin-resistant genes among microbes. The objective of this project is to analyze the diversity of these genes found in the soil microbes from Miami-Dade County. Bacterial isolates were Gram-stained and the Kirby-Bauer antibiotic disk diffusion test was performed to determine the degree of resistance. Results showed that all bacterial isolates were resistant to penicillin at the 10 µg concentration and most were susceptible to varying vancomycin concentrations (10 µg, 20 µg, and 30 µg). A 1465 bp fragment was amplified from the 16S rDNA gene using 27F and 1492R universal primers from the multi-antibiotic resistant bacteria and sequenced to identify the isolates. Three Gram-negative bacteria genera were identified with the closest phylogenetic match to: Pseudomonas sp., Stenotrophomonas sp., Xanthomonas sp., as well as two Gram-positive bacteria genera: Bacillus sp. and Brevibacillus sp. The isolates’ vanA and vanB genes were amplified using the respective primers. Ongoing work is underway to sequence and compare these known van resistant genes, with the goal of revealing intrinsic vancomycin resistance present in soil bacteria.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

Trypanosomiasis has been identified as a neglected tropical disease in both humans and animals in many regions of sub-Saharan Africa. Whilst assessments of the biology of trypanosomes, vectors, vertebrate hosts and the environment have provided useful information about life cycles, transmission, and pathogenesis of the parasites that could be used for treatment and control, less information is available about the effects of interactions among multiple intrinsic factors on trypanosome presence in tsetse flies from different sites. It is known that multiple species of tsetse flies can transmit trypanosomes but differences in their vector competence has normally been studied in relation to individual factors in isolation, such as: intrinsic factors of the flies (e.g. age, sex); habitat characteristics; presence of endosymbionts (e.g. Wigglesworthia glossinidia, Sodalis glossinidius); feeding pattern; host communities that the flies feed on; and which species of trypanosomes are transmitted. The purpose of this study was to take a more integrated approach to investigate trypanosome prevalence in tsetse flies. In chapter 2, techniques were optimised for using the Polymerase Chain Reaction (PCR) to identify species of trypanosomes (Trypanosoma vivax, T. congolense, T. brucei, T. simiae, and T. godfreyi) present in four species of tsetse flies (Glossina austeni, G. brevipalpis, G. longipennis and G. pallidipes) from two regions of eastern Kenya (the Shimba Hills and Nguruman). Based on universal primers targeting the internal transcribed spacer 1 region (ITS-1), T. vivax was the predominant pathogenic species detected in flies, both singly and in combination with other species of trypanosomes. Using Generalised Linear Models (GLMs) and likelihood ratio tests to choose the best-fitting models, presence of T. vivax was significantly associated with an interaction between subpopulation (a combination between collection sites and species of Glossina) and sex of the flies (X2 = 7.52, df = 21, P-value = 0.0061); prevalence in females overall was higher than in males but this was not consistent across subpopulations. Similarly, T. congolense was significantly associated only with subpopulation (X2 = 18.77, df = 1, P-value = 0.0046); prevalence was higher overall in the Shimba Hills than in Nguruman but this pattern varied by species of tsetse fly. When associations were analysed in individual species of tsetse flies, there were no consistent associations between trypanosome prevalence and any single factor (site, sex, age) and different combinations of interactions were found to be significant for each. The results thus demonstrated complex interactions between vectors and trypanosome prevalence related to both the distribution and intrinsic factors of tsetse flies. The potential influence of the presence of S. glossinidius on trypanosome presence in tsetse flies was studied in chapter 3. A high number of Sodalis positive flies was found in the Shimba Hills, while there were only two positive flies from Nguruman. Presence or absence of Sodalis was significantly associated with subpopulation while trypanosome presence showed a significant association with age (X2 = 4.65, df = 14, P-value = 0.0310) and an interaction between subpopulation and sex (X2 = 18.94, df = 10, P-value = 0.0043). However, the specific associations that were significant varied across species of trypanosomes, with T. congolense and T. brucei but not T. vivax showing significant interactions involving Sodalis. Although it has previously been concluded that presence of Sodalis increases susceptibility to trypanosomes, the results presented here suggest a more complicated relationship, which may be biased by differences in the distribution and intrinsic factors of tsetse flies, as well as which trypanosome species are considered. In chapter 4 trypanosome status was studied in relation to blood meal sources, feeding status and feeding patterns of G. pallidipes (which was the predominant fly species collected for this study) as determined by sequencing the mitochondrial cytochrome B gene using DNA extracted from abdomen samples. African buffalo and African elephants were the main sources of blood meals but antelopes, warthogs, humans, giraffes and hyenas were also identified. Feeding on multiple hosts was common in flies sampled from the Shimba Hills but most flies from Nguruman had fed on single host species. Based on Multiple Correspondence Analysis (MCA), host-feeding patterns showed a correlation with site of sample collection and Sodalis status, while trypanosome status was correlated with sex and age of the flies, suggesting that recent host-feeding patterns from blood meal analysis cannot predict trypanosome status. In conclusion, the complexity of interactions found suggests that strategies of tsetse fly control should be specific to particular epidemic areas. Future studies should include laboratory experiments that use local colonies of tsetse flies, local strains of trypanosomes and local S. glossinidius under controlled environmental conditions to tease out the factors that affect vector competence and the relative influence of external environmental factors on the dynamics of these interactions.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

Objectives: To investigate the adhesive potential of novel zirconia primers and universal adhesives to surface-treated zirconia substrates.Methods: Zirconia bars were manufactured (3.0 mm x 3.0 mm x 9.0 mm) and treated as follows: no treatment (C); air abrasion with 35 mu m alumina particles (S); air abrasion with 30 mu m silica particles using one of two systems (Rocatec or SilJet) and; glazing (G). Groups C and S were subsequentially treated with one of the following primers or adhesives: ZP (Z-Prime Plus), AZ (AZ Primer); MP (Monobond Plus); SU (ScotchBond Universal) and; EA (an Experimental Adhesive). Groups Rocatec and SilJet were silanized prior to cementation. Samples form group G were further etched and silanized. Bars were cemented (Multilink) onto bars of a silicate-based ceramic (3.0 mm x 3.0 mm x 9.0 mm) at 90 degrees angle, thermocycled (2.500 cycles, 5-55 degrees C, 30 s dwell time), and tested in tensile strength test. Failure analysis was performed on fractured specimens to measure the bonding area and crack origin.Results: Specimens from group C did not survive thermocycling, while CMP, CSU and CEA groups survived thermocycling but rendered low values of bond strength. All primers presented a better bond performance after air abrasion with Al2O3 particles. SilJet was similar to Rocatec, both presenting the best bond strength results, along with SMP, SSU and CEA. G promoted intermediate bond strength values. Failure mode was predominately adhesive on zirconia surface combined to cohesive of the luting agent.Conclusions: Universal adhesives (MP, SU, EA) may be a considerable alternative for bonding to zirconia, but air abrasion is still previously required. Air abrasion with silica particles followed by silane application also presented high bond strength values. (C) 2013 Elsevier Ltd. All rights reserved.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The objective of this work was to standardize a semiautomated method for genotyping soybean, based on universal tail sequence primers (UTSP), and to compare it with the conventional genotyping method that uses electrophoresis in polyacrylamide gels. Thirty soybean cultivars were genotypically characterized by both methods, using 13 microsatellite loci. For the UTSP method, the number of alleles (NA) was 50 (2-7 per marker) and the polymorphic information content (PIC) ranged from 0.40 to 0.74. For the conventional method, the NA was 38 (2-5 per marker) and the PIC varied from 0.39 to 0.67. The genetic dissimilarity matrices obtained by the two methods were highly correlated with each other (0.8026), and the formed groups were coherent with the phenotypic data used for varietal registration. The 13 markers allowed the distinction of all analyzed cultivars. The low cost of the UTSP method, associated with its high accuracy, makes it ideal for the characterization of soybean cultivars and for the determination of genetic purity.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Transcriptase reverse - polymerase chain reaction (RT-PCR) and dot blot hybridization with digoxigenin-labeled probes were applied for the universal detection of Tospovirus species. The virus species tested were Tomato spotted wilt virus, Tomato chlorotic spot virus, Groundnut ringspot virus, Chrysanthemum stem necrosis virus, Impatiens necrotic spot virus, Zucchini lethal chlorosis virus, Iris yellow spot virus. Primers for PCR amplification were designed to match conserved regions of the tospovirus genome. RT-PCR using distinct primer combinations was unable to simultaneously amplify all tospovirus species and consistently failed to detect ZLCV and IYSV in total RNA extracts. However, all tospovirus species were detected by RT-PCR when viral RNA was used as template. RNA-specific PCR products were used as probes for dot hybridization. This assay with a M probe (directed to the G1/G2 gene) detected at low stringency conditions all Tospovirus species, except IYSV. At low stringency conditions, the L non-radioactive probe detected the seven Tospovirus species in a single assay. This method for broad spectrum detection can be potentially employed in quarantine services for indexing in vitro germplasm.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The recovery and stability of DNA for the detection and genotyping of HPV in UCM-containing specimens, after exposure to denaturing reagents and stored for up to 2 years were evaluated. Samples were collected from 60 women who had cervical cytology specimens harboring cervical intraepithelial neoplasia (CIN) 2 or 3. All samples were stored in UCM and had been frozen at -20 degrees C following the addition of the denaturing reagent (sodium hydroxide) and the removal of the aliquot required for Hybrid Capture 2 testing for the identification of HPV DNA. The samples had been stored for 6, 12 and 24 months (20 samples for each storage time). HPV DNA extraction was performed according to a protocol designed specifically and the presence and quality of DNA was confirmed by human P-globin detection using the consensus primers G73 and G74. HPV DNA was amplified using the consensus primers PGMY09 and PGMY11, and reverse line-blot hybridization was used to detect type-specific amplicons for 37 HPV types. The DNA extracted from the denatured specimen was recovered in 57/60 (95%) of the samples. HPV DNA was detected in 56/57 (98%) of the recovered samples. Twenty-six of the 56 samples recovered (48%) were genotyped successfully. (c) 2007 Elsevier B.V. All rights reserved.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The objective of this study was to evaluate the influence of different primers on the microtensile bond strength (μT BS) between a feldspathic ceramic and two composites. Forty blocks (6.0 × 6.0 × 5.0 mm 3) were prepared from Vita Mark II . After polishing, they were randomly divided into 10 groups according to the surface treatment: Group 1, hydrofluoric acid 10% (HF) + silane; Group 2, CoJet + silane; Group 3, HF + Metal/Zirconia Primer; Group 4, HF + Clearfil Primer; Group 5, HF + Alloy Primer; Group 6, HF + V-Primer; Group 7, Metal/Zirconia Primer; Group 8, Clearfil Primer; Group 9, Alloy Primer; Group 10, V-Primer. After each surface treatment, an adhesive was applied and one of two composite resins was incrementally built up. The sticks obtained from each block (bonded area: 1.0 mm2 ± 0.2 mm) were stored in distilled water at 37°C for 30 days and submitted to thermocycling (7,000 cycles; 5°C/55°C ± 1°C). The μT BS test was carried out using a universal testing machine (1.0 mm/min). Data were analyzed using ANOVA and a Tukey test (α = 0.05). The surface treatments significantly affected the results (P < 0.05); no difference was observed between the composites (P > 0.05). The bond strength means (MPa) were as follows: Group 1a = 29.6; Group 1b = 33.7; Group 2a = 28.9; Group 2b = 27.1; Group 3a = 13.8; Group 3b = 14.9; Group 4a = 18.6; Group 4b = 19.4; Group 5a = 15.3; Group 5b = 16.5; Group 6a = 11; Group 6b = 18; Groups 7a to 10b = 0. While the use of primers alone was not sufficient for adequate bond strengths to feldspathic ceramic, HF etching followed by any silane delivered higher bond strength.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

A rapid and simple DNA labeling system has been developed for disposable microarrays and has been validated for the detection of 117 antibiotic resistance genes abundant in Gram-positive bacteria. The DNA was fragmented and amplified using phi-29 polymerase and random primers with linkers. Labeling and further amplification were then performed by classic PCR amplification using biotinylated primers specific for the linkers. The microarray developed by Perreten et al. (Perreten, V., Vorlet-Fawer, L., Slickers, P., Ehricht, R., Kuhnert, P., Frey, J., 2005. Microarray-based detection of 90 antibiotic resistance genes of gram-positive bacteria. J.Clin.Microbiol. 43, 2291-2302.) was improved by additional oligonucleotides. A total of 244 oligonucleotides (26 to 37 nucleotide length and with similar melting temperatures) were spotted on the microarray, including genes conferring resistance to clinically important antibiotic classes like β-lactams, macrolides, aminoglycosides, glycopeptides and tetracyclines. Each antibiotic resistance gene is represented by at least 2 oligonucleotides designed from consensus sequences of gene families. The specificity of the oligonucleotides and the quality of the amplification and labeling were verified by analysis of a collection of 65 strains belonging to 24 species. Association between genotype and phenotype was verified for 6 antibiotics using 77 Staphylococcus strains belonging to different species and revealed 95% test specificity and a 93% predictive value of a positive test. The DNA labeling and amplification is independent of the species and of the target genes and could be used for different types of microarrays. This system has also the advantage to detect several genes within one bacterium at once, like in Staphylococcus aureus strain BM3318, in which up to 15 genes were detected. This new microarray-based detection system offers a large potential for applications in clinical diagnostic, basic research, food safety and surveillance programs for antimicrobial resistance.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

36

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física