Harnessing linked knowledge sources for topic classification in social media

Topic classification (TC) of short text messages offers an effective and fast way to reveal events happening around the world ranging from those related to Disaster (e.g. Sandy hurricane) to those related to Violence (e.g. Egypt revolution). Previous approaches to TC have mostly focused on exploiting individual knowledge sources (KS) (e.g. DBpedia or Freebase) without considering the graph structures that surround concepts present in KSs when detecting the topics of Tweets. In this paper we introduce a novel approach for harnessing such graph structures from multiple linked KSs, by: (i) building a conceptual representation of the KSs, (ii) leveraging contextual information about concepts by exploiting semantic concept graphs, and (iii) providing a principled way for the combination of KSs. Experiments evaluating our TC classifier in the context of Violence detection (VD) and Emergency Responses (ER) show promising results that significantly outperform various baseline models including an approach using a single KS without linked data and an approach using only Tweets. Copyright 2013 ACM.

An unsupervised Bayesian modelling approach to storyline detection from news articles

Storyline detection from news articles aims at summarizing events described under a certain news topic and revealing how those events evolve over time. It is a difficult task because it requires first the detection of events from news articles published in different time periods and then the construction of storylines by linking events into coherent news stories. Moreover, each storyline has different hierarchical structures which are dependent across epochs. Existing approaches often ignore the dependency of hierarchical structures in storyline generation. In this paper, we propose an unsupervised Bayesian model, called dynamic storyline detection model, to extract structured representations and evolution patterns of storylines. The proposed model is evaluated on a large scale news corpus. Experimental results show that our proposed model outperforms several baseline approaches.

Semantic feature-based visual attention model for pedestrian detection

Objective
Pedestrian detection under video surveillance systems has always been a hot topic in computer vision research. These systems are widely used in train stations, airports, large commercial plazas, and other public places. However, pedestrian detection remains difficult because of complex backgrounds. Given its development in recent years, the visual attention mechanism has attracted increasing attention in object detection and tracking research, and previous studies have achieved substantial progress and breakthroughs. We propose a novel pedestrian detection method based on the semantic features under the visual attention mechanism.
Method
The proposed semantic feature-based visual attention model is a spatial-temporal model that consists of two parts: the static visual attention model and the motion visual attention model. The static visual attention model in the spatial domain is constructed by combining bottom-up with top-down attention guidance. Based on the characteristics of pedestrians, the bottom-up visual attention model of Itti is improved by intensifying the orientation vectors of elementary visual features to make the visual saliency map suitable for pedestrian detection. In terms of pedestrian attributes, skin color is selected as a semantic feature for pedestrian detection. The regional and Gaussian models are adopted to construct the skin color model. Skin feature-based visual attention guidance is then proposed to complete the top-down process. The bottom-up and top-down visual attentions are linearly combined using the proper weights obtained from experiments to construct the static visual attention model in the spatial domain. The spatial-temporal visual attention model is then constructed via the motion features in the temporal domain. Based on the static visual attention model in the spatial domain, the frame difference method is combined with optical flowing to detect motion vectors. Filtering is applied to process the field of motion vectors. The saliency of motion vectors can be evaluated via motion entropy to make the selected motion feature more suitable for the spatial-temporal visual attention model.
Result
Standard datasets and practical videos are selected for the experiments. The experiments are performed on a MATLAB R2012a platform. The experimental results show that our spatial-temporal visual attention model demonstrates favorable robustness under various scenes, including indoor train station surveillance videos and outdoor scenes with swaying leaves. Our proposed model outperforms the visual attention model of Itti, the graph-based visual saliency model, the phase spectrum of quaternion Fourier transform model, and the motion channel model of Liu in terms of pedestrian detection. The proposed model achieves a 93% accuracy rate on the test video.
Conclusion
This paper proposes a novel pedestrian method based on the visual attention mechanism. A spatial-temporal visual attention model that uses low-level and semantic features is proposed to calculate the saliency map. Based on this model, the pedestrian targets can be detected through focus of attention shifts. The experimental results verify the effectiveness of the proposed attention model for detecting pedestrians.

Radio frequency communication and fault detection for railway signalling

The continuous and swift progression of both wireless and wired communication technologies in today's world owes its success to the foundational systems established earlier. These systems serve as the building blocks that enable the enhancement of services to cater to evolving requirements. Studying the vulnerabilities of previously designed systems and their current usage leads to the development of new communication technologies replacing the old ones such as GSM-R in the railway field. The current industrial research has a specific focus on finding an appropriate telecommunication solution for railway communications that will replace the GSM-R standard which will be switched off in the next years. Various standardization organizations are currently exploring and designing a radiofrequency technology based standard solution to serve railway communications in the form of FRMCS (Future Railway Mobile Communication System) to substitute the current GSM-R. Bearing on this topic, the primary strategic objective of the research is to assess the feasibility to leverage on the current public network technologies such as LTE to cater to mission and safety critical communication for low density lines. The research aims to identify the constraints, define a service level agreement with telecom operators, and establish the necessary implementations to make the system as reliable as possible over an open and public network, while considering safety and cybersecurity aspects. The LTE infrastructure would be utilized to transmit the vital data for the communication of a railway system and to gather and transmit all the field measurements to the control room for maintenance purposes. Given the significance of maintenance activities in the railway sector, the ongoing research includes the implementation of a machine learning algorithm to detect railway equipment faults, reducing time and human analysis errors due to the large volume of measurements from the field.

Proximity detection protocols for IoT devices

In recent years, we have witnessed the growth of the Internet of Things paradigm, with its increased pervasiveness in our everyday lives. The possible applications are diverse: from a smartwatch able to measure heartbeat and communicate it to the cloud, to the device that triggers an event when we approach an exhibit in a museum. Present in many of these applications is the Proximity Detection task: for instance the heartbeat could be measured only when the wearer is near to a well defined location for medical purposes or the touristic attraction must be triggered only if someone is very close to it. Indeed, the ability of an IoT device to sense the presence of other devices nearby and calculate the distance to them can be considered the cornerstone of various applications, motivating research on this fundamental topic. The energy constraints of the IoT devices are often in contrast with the needs of continuous operations to sense the environment and to achieve high accurate distance measurements from the neighbors, thus making the design of Proximity Detection protocols a challenging task.

Advancing Bag-of-visual-words Representations For Lesion Classification In Retinal Images.

Diabetic Retinopathy (DR) is a complication of diabetes that can lead to blindness if not readily discovered. Automated screening algorithms have the potential to improve identification of patients who need further medical attention. However, the identification of lesions must be accurate to be useful for clinical application. The bag-of-visual-words (BoVW) algorithm employs a maximum-margin classifier in a flexible framework that is able to detect the most common DR-related lesions such as microaneurysms, cotton-wool spots and hard exudates. BoVW allows to bypass the need for pre- and post-processing of the retinographic images, as well as the need of specific ad hoc techniques for identification of each type of lesion. An extensive evaluation of the BoVW model, using three large retinograph datasets (DR1, DR2 and Messidor) with different resolution and collected by different healthcare personnel, was performed. The results demonstrate that the BoVW classification approach can identify different lesions within an image without having to utilize different algorithms for each lesion reducing processing time and providing a more flexible diagnostic system. Our BoVW scheme is based on sparse low-level feature detection with a Speeded-Up Robust Features (SURF) local descriptor, and mid-level features based on semi-soft coding with max pooling. The best BoVW representation for retinal image classification was an area under the receiver operating characteristic curve (AUC-ROC) of 97.8% (exudates) and 93.5% (red lesions), applying a cross-dataset validation protocol. To assess the accuracy for detecting cases that require referral within one year, the sparse extraction technique associated with semi-soft coding and max pooling obtained an AUC of 94.2 ± 2.0%, outperforming current methods. Those results indicate that, for retinal image classification tasks in clinical practice, BoVW is equal and, in some instances, surpasses results obtained using dense detection (widely believed to be the best choice in many vision problems) for the low-level descriptors.

The Lea Grating Test In Assessing Detection Grating Acuity In Normal Infants Less Than 4 Months Of Age.

To assess binocular detection grating acuity using the LEA GRATINGS test to establish age-related norms in healthy infants during their first 3 months of life. In this prospective, longitudinal study of healthy infants with clear red reflex at birth, responses to gratings were measured at 1, 2, and 3 months of age using LEA gratings at a distance of 28 cm. The results were recorded as detection grating acuity values, which were arranged in frequency tables and converted to a one-octave scale for statistical analysis. For the repeated measurements, analysis of variance (ANOVA) was used to compare the detection grating acuity results between ages. A total of 133 infants were included. The binocular responses to gratings showed development toward higher mean values and spatial frequencies, ranging from 0.55 ± 0.70 cycles per degree (cpd), or 1.74 ± 0.21 logMAR, in month 1 to 3.11 ± 0.54 cpd, or 0.98 ± 0.16 logMAR, in month 3. Repeated ANOVA indicated differences among grating acuity values in the three age groups. The LEA GRATINGS test allowed assessment of detection grating acuity and its development in a cohort of healthy infants during their first 3 months of life.

Determination Of Tetrakis(hydroxymethyl)phosphonium Sulfate In Commercial Formulations And Cooling Water By Capillary Electrophoresis With Contactless Conductivity Detection.

A novel capillary electrophoresis method using capacitively coupled contactless conductivity detection is proposed for the determination of the biocide tetrakis(hydroxymethyl)phosphonium sulfate. The feasibility of the electrophoretic separation of this biocide was attributed to the formation of an anionic complex between the biocide and borate ions in the background electrolyte. Evidence of this complex formation was provided by (11) B NMR spectroscopy. A linear relationship (R(2) = 0.9990) between the peak area of the complex and the biocide concentration (50-900 μmol/L) was found. The limit of detection and limit of quantification were 15.0 and 50.1 μmol/L, respectively. The proposed method was applied to the determination of tetrakis(hydroxymethyl)phosphonium sulfate in commercial formulations, and the results were in good agreement with those obtained by the standard iodometric titration method. The method was also evaluated for the analysis of tap water and cooling water samples treated with the biocide. The results of the recovery tests at three concentration levels (300, 400, and 600 μmol/L) varied from 75 to 99%, with a relative standard deviation no higher than 9%.

Human Herpesvirus Infections Of The Central Nervous System: Laboratory Diagnosis Based On Dna Detection By Nested Pcr In Plasma And Cerebrospinal Fluid Samples.

Infections of the central nervous systems (CNS) present a diagnostic problem for which an accurate laboratory diagnosis is essential. Invasive practices, such as cerebral biopsy, have been replaced by obtaining a polymerase chain reaction (PCR) diagnosis using cerebral spinal fluid (CSF) as a reference method. Tests on DNA extracted from plasma are noninvasive, thus avoiding all of the collateral effects and patient risks associated with CSF collection. This study aimed to determine whether plasma can replace CSF in nested PCR analysis for the detection of CNS human herpesvirus (HHV) diseases by analysing the proportion of patients whose CSF nested PCR results were positive for CNS HHV who also had the same organism identified by plasma nested PCR. In this study, CSF DNA was used as the gold standard, and nested PCR was performed on both types of samples. Fifty-two patients with symptoms of nervous system infection were submitted to CSF and blood collection. For the eight HHV, one positive DNA result-in plasma and/or CSF nested PCR-was considered an active HHV infection, whereas the occurrence of two or more HHVs in the same sample was considered a coinfection. HHV infections were positively detected in 27/52 (51.9%) of the CSF and in 32/52 (61.5%) of the plasma, difference not significant, thus nested PCR can be performed on plasma instead of CSF. In conclusion, this findings suggest that plasma as a useful material for the diagnosis of cases where there is any difficulty to perform a CSF puncture.

Detection Of Explosives On The Surface Of Banknotes By Raman Hyperspectral Imaging And Independent Component Analysis.

The aim of this study was to develop a methodology using Raman hyperspectral imaging and chemometric methods for identification of pre- and post-blast explosive residues on banknote surfaces. The explosives studied were of military, commercial and propellant uses. After the acquisition of the hyperspectral imaging, independent component analysis (ICA) was applied to extract the pure spectra and the distribution of the corresponding image constituents. The performance of the methodology was evaluated by the explained variance and the lack of fit of the models, by comparing the ICA recovered spectra with the reference spectra using correlation coefficients and by the presence of rotational ambiguity in the ICA solutions. The methodology was applied to forensic samples to solve an automated teller machine explosion case. Independent component analysis proved to be a suitable method of resolving curves, achieving equivalent performance with the multivariate curve resolution with alternating least squares (MCR-ALS) method. At low concentrations, MCR-ALS presents some limitations, as it did not provide the correct solution. The detection limit of the methodology presented in this study was 50μgcm(-2).

A screening method for detection of hexavalent chromium levels in soils

A rapid and low cost method to determine Cr(VI) in soils based upon alkaline metal extraction at room temperature is proposed as a semi-quantitative procedure to be performed in the field. A color comparison with standards with contents of Cr(VI) in the range of 10 to 150 mg kg-1 was used throughout. For the different types of soils studied, more than 75% of the fortified soluble Cr(VI) were recovered for all levels of spike tested for both the proposed and standard methods. Recoveries of 83 and 99% were obtained for the proposed and the standard methods, respectively, taking into account the analysis of a heavily contaminated soil sample.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Detection of human cytomegalovirus and Epstein-Barr virus in coronary atherosclerotic tissue

Previous studies indicated that patients with atherosclerosis are predominantly infected by human cytomegalovirus (HCMV), but rarely infected by type 1 Epstein-Barr virus (EBV-1). In this study, atheromas of 30 patients who underwent aortocoronary bypass surgery with coronary endartherectomy were tested for the presence of these two viruses. HCMV occurred in 93.3% of the samples and EBV-1 was present in 50% of them. Concurrent presence of both pathogens was detected in 43.3% of the samples.

Validity and reliability of methods for the detection of secondary caries around amalgam restorations in primary teeth

Secondary caries has been reported as the main reason for restoration replacement. The aim of this in vitro study was to evaluate the performance of different methods - visual inspection, laser fluorescence (DIAGNOdent), radiography and tactile examination - for secondary caries detection in primary molars restored with amalgam. Fifty-four primary molars were photographed and 73 suspect sites adjacent to amalgam restorations were selected. Two examiners evaluated independently these sites using all methods. Agreement between examiners was assessed by the Kappa test. To validate the methods, a caries-detector dye was used after restoration removal. The best cut-off points for the sample were found by a Receiver Operator Characteristic (ROC) analysis, and the area under the ROC curve (Az), and the sensitivity, specificity and accuracy of the methods were calculated for enamel (D2) and dentine (D3) thresholds. These parameters were found for each method and then compared by the McNemar test. The tactile examination and visual inspection presented the highest inter-examiner agreement for the D2 and D3 thresholds, respectively. The visual inspection also showed better performance than the other methods for both thresholds (Az = 0.861 and Az = 0.841, respectively). In conclusion, the visual inspection presented the best performance for detecting enamel and dentin secondary caries in primary teeth restored with amalgam.

Spatial pattern detection modeling of thrips (Thrips tabaci) on onion fields

Onion (Allium cepa) is one of the most cultivated and consumed vegetables in Brazil and its importance is due to the large laborforce involved. One of the main pests that affect this crop is the Onion Thrips (Thrips tabaci), but the spatial distribution of this insect, although important, has not been considered in crop management recommendations, experimental planning or sampling procedures. Our purpose here is to consider statistical tools to detect and model spatial patterns of the occurrence of the onion thrips. In order to characterize the spatial distribution pattern of the Onion Thrips a survey was carried out to record the number of insects in each development phase on onion plant leaves, on different dates and sample locations, in four rural properties with neighboring farms under different infestation levels and planting methods. The Mantel randomization test proved to be a useful tool to test for spatial correlation which, when detected, was described by a mixed spatial Poisson model with a geostatistical random component and parameters allowing for a characterization of the spatial pattern, as well as the production of prediction maps of susceptibility to levels of infestation throughout the area.