Testosterona e gonadotrofina coriônica humana estimulam a esteroidogênese em células da granulosa de folículo pré-ovulatório de égua?

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Avaliação dos níveis séricos de 17-alfa-OH progesterona e androstenediona durante o ciclo estral em marrãs (Sus Scrofa Domestica - Linnaeus, 1758)

No presente trabalho, foram utilizadas 21 fêmeas suínas, virgens, sexualmente aptas, criadas e mantidas sob condições industriais, para observação dos perfis hormonais séricos de 17-alfa-OH progesterona e androstenediona, durante o ciclo estral. As colheitas de sangue foram efetuadas sempre no mesmo intervalo, entre 8 e 10 horas. Cada animal foi submetido a 14 punções venosas, distribuídas nos dias zero, 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 21, 22 e 23 do ciclo estral. Considerou-se o dia zero como o primeiro dia da fase estral, e o 23º dia como o primeiro do estro subseqüente. Os ensaios para dosagens hormonais foram executados utilizando-se a técnica de radioimunoensaio (RIE) em fase sólida e para isso foi empregado conjunto de reagentes comerciais (Coat-A-Count®). Para o hormônio 17-alfa-OH progesterona, foram encontrados valores médios que variaram entre 0,18 e 2,7 ng/ml e para o hormônio androstenediona esses valores oscilaram entre 0,08 e 0,24 ng/ml.

Padronização da metodologia do RT-PCR utilizado para identificação do mRNA da alfa-amilase em sementes de milho

Durante a germinação das sementes, os carboidratos de reserva são degradados pela atividade de a-amilase. A identificação de mRNA é uma ferramenta fundamental para a definição da cinética de síntese de alfa-amilase. Objetivou-se padronizar a metodologia do RT-PCR para identificar o mRNA do gene de a-amilase em sementes de milho. Após três dias de germinação das cultivares Saracura-BRS 4154 e CATI-AL34, extraiu-se o RNA total pelo método do tiocianato de guanidina-fenol-clorofórmio, com algumas modificações. A partir do RNA total extraído foi obtido cDNA com utilização de random primers. A amplificação por PCR de uma porção do gene da alfa-amilase foi realizada com os primers: sense - CGACATCGACCACCTCAAC; antisense - TTGACCAGCTCCTGCCTGTC; gelatina; DMSO e 1,25 unidades de Taq DNA polimerase por reação e completados com água tratada com DEPC. Os ciclos para a amplificação foram 94ºC durante 4 minutos, seguidos por 34 ciclos de 94ºC durante 1 minuto, 42ºC durante 1 minuto e 72ºC durante 1,5 minutos e, finalmente, 72ºC por 5 minutos. O produto do RT-PCR apresentou uma banda de 249 pares de base (pb) bem definida, para as duas cultivares estudadas, não ocorrendo bandas inespecíficas. A técnica do RT-PCR mostrou ser uma metodologia eficiente para a identificação da expressão de alfa-amilase durante a germinação das sementes e pode ser usado para estudo qualitativo e quantitativo da cinética de síntese dessa enzima em experimentos de germinação.

Comportamento elétrico a alta temperatura de termistor cerâmico alfa-Fe2O3 com coeficiente de temperatura negativo

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Prevalência de talassemia alfa+ (deleção -3.7) na população adulta do estado do Rio Grande do Norte

Alpha thalassemia, the most common monogenic disorder in the world, is characterized by deletions of one (+-thalassemia) or both alpha genes (0-thalassemia) located on human chromosome 16 (16p13.3). The most common case of +-thalassemia is a deletion of 3.7 kb of DNA (-3.7 deletion). It is most prevalent in African and Middle East regions. In the few studies carried out in Brazilian population -3.7 deletion was the most common deletion, mainly in African descendants. This study was conducted to determine the prevalence of +- thalassemia (deletion 3.7kb) in adult population from Rio Grande do Norte. We obtained blood samples from 713 unrelated individuals of both genders, aged between 18 and 59 years old. All individuals were born in Rio Grande do Norte. The hematological indices were obtained in an automatic cell counter (Micros 60, ABX Diagnostics). The hemoglobin measurement (A2 and Fetal hemoglobin) and the profile confirmation were carried out by high performance liquid chromatography (HPLC) methodology. Genomic DNA was obtained from peripheral blood leukocytes using Illustra Blood GenomicPrep Mini Spin kit and -3.7 deletion was investigated by PCR. Among the 713 individuals studied, 80 (11,2%) presented +- thalassemia: 79 (11,1%) were heterozygous and 1 (0,1%) homozygous for the -3.7 deletion. Considering the ethnic group, negroes showed the greatest prevalence of +-thalassemia (12,5%), followed by mulattoes (12,3%) and caucasian (9,6%). Statistical comparison of hematological parameters between normal individuals and heterozygous to +-thalassemia showed significant differences in RBC (p<0,001), MCV (p<0,001), MCH (p<0,001), Hb A2 (p=0,007) as well as female hemoglobin concentration (p=0,003). This is one of the first studies to research +-thalassemia in general population of Rio Grande do Norte state and these results attest the importance of investigation of this condition to define the etiology of microcytosis and hypochromia.

Influência do desenvolvimento etário e da suplementação com vitamina E (acetato de DL-alfa-tocoferol) no metabolismo oxidativo dos neutrófilos de bovinos da raça Holandesa (Bos taurus)

O presente trabalho teve por objetivo analisar a influência do desenvolvimento etário e da suplementação com acetato de DL-alfa-tocoferol sobre o metabolismo oxidativo de neutrófilos, em bovinos da raça holandesa, no período do nascimento até os 150 dias de idade. Foram utilizados 20 bezerros divididos em dois grupos de dez animais. Os animais do grupo Tratamento receberam 2000UI de acetato de DL-alfa-tocoferol, por via intramuscular, ao nascimento, aos 15, 30, 60, 90 e 120 dias de idade, sendo o outro o grupo Controle, que não recebeu qualquer suplementação. em ambos os grupos, o metabolismo oxidativo dos neutrófilos demonstrou pouca atividade durante os primeiros 60 dias de vida, sendo indicativo da ineficiência deste importante mecanismo bactericida. Não foi observado efeito significativo da administração do acetato de DL-alfa-tocoferol sobre o metabolismo oxidativo de neutrófilos.

Hemoglobin as AS/alfa talassemia - Importância diagnóstica

Sickle Cell disease is a generic term for a group of genetic disorders characterized by the predominance of hemoglobin S. These disorders include Sickle Cell anemia, the Sickle Cell beta Thalassemia syndromes and Hemoglobinopathies in which hemoglobin S is in association with another abnormal hemoglobin, such as hemoglobin S/C. The Sickle Cell trait (hemoglobin AS) associated with Alpha Thalassemia presents alterations in the red blood cells morphology, usually absent in the heterozygous for this hemoglobin variant. The interaction between hemoglobin Sand alpha Thalassemia has been described as one of the factors responsible for the improvement in the clinical picture of homozygous of hemoglobin S (Sickle Cell Anemia), decreasing the number of episodes of pain. The genetic mechanisms of this influence are evaluated using molecular analyses of the human globin genes. With the objective of verifying the presence of alpha Thalassemia in heterozygous of hemoglobin S, with anemia, sent to the Laboratory of Hemoglobins, Department of Biology, UNESP, São José do Rio Preto, SP, we analyzed 1002 blood samples with Sickle Cell trait, in the period from 1990 to 1998. The samples were picked with EDTA 5% as anticoagulant, after previous authorization of the carriers. Appropriated counseling and management requires definitive diagnosis. For the laboratorial diagnosis the blood samples were submitted to electrophoretic procedures in alkaline and acid pH and cytological evaluation of hemoglobin H. The electrophoretic procedures confirmed the presence of hemoglobin AS. The cytological evaluation evidenced the presence of alpha Thalassemia. Of this total analyzed, 16(1,59%) blood samples presented the association between hemoglobin AS and alpha Thalassemia and two individuals belonged of the same family. Our results addressed us to suggest to the routine laboratories, that is important to accomplish the research of alpha Thalassemia among the Sickle Cell trait, with anemia, to verify the interaction with alpha Thalassemia, supplying to the carriers a important information on its hematological profile, genetic pattern of hemoglobinopathies and the appropriated counseling. Rev.bras.hematol.hemoter.,2000,22(3):388-394.

Efeito da testosterona no desenvolvimento de Chrysomya albiceps (Wiedemann) (Diptera: Calliphoridae)

Medico-Legal or Forensic Entomology can be defined as the application of the study of insects and other arthropods which, in association with criminalistic processes, have the the purpose of desovering useful information for an investigation. Nowadays, the insects are a reliable alternative for toxicological analysis, especially when tissues and liquids usually required for this purpose are absent, once insects store some ingested substances which can change their growth rate, being this a relevant fact in the determination of the cause and the time since death. Previous experiments in our laboratory on the testosterone effects on body decomposition suggested that this hormone could interfere in the cadaveric fauna development. With the objective of investigating testosterone influence on the Chrysomya albiceps larval development, a common species in cadaveric fauna, an experimental study was done from eggs of a laboratory maintained colony of this species. The eggs were divided in four groups of 30 and put in glass flasks with 50g of artificial diet in each of them, with testosterone being added in two of them. The larvae were weighted each 12 h during all interval of the larval growing. The studied larvae did not present any difference in the stages of development, but larvae from the experimental group had 5 times the weight of the larvae from the control group and with bigger size. This result shows a significant influence of testosterone in the growth of C. albiceps.

Polimorfismo nos genes metilenotetrahidrofolato redutase e cistationina-beta-sintase e a sua relação com eventos vaso-oclusivos na doença falciforme

Sickle cell disease is an inflammatory condition with a pathophysiology that involves vaso-occlusive episodes. Mutations of the methylenetetrahydrofolate reductase (MTHFR) and cystathionine beta-synthase (CBS) genes are risk factors for vascular disease. Due to the importance of identifying risk factors for vaso-occlusive events in sickle cell patients, we investigated the frequencies of the C677T and 844ins68 mutations of the MTHFR and CBS genes, respectively. Three hundred patients with Hb SS, HB SC and HbS/Beta thalassemia, from Brasília, Goiânia, Rio de Janeiro, São Jose do Rio Preto and São Paulo were evaluated. Samples of 5 mL of venous blood were collected in EDTA after informed consent was received from patients. Classical diagnostic methods were used to confirm the hemoglobin phenotypes. The hemoglobin genotypes and polymorphisms studied were evaluated by Restriction Fragment Length Polymorphism and Allele Specific amplification. The results showed that 93 patients (31.00%) were heterozygous and 13 (4.33%) homozygous for the C677T mutation and 90 were heterozygotes (30.00%) and 8 homozygous (2.66%) for the 844ins68 mutation, both with significant differences for genotype frequency between the localities. The allelic frequencies are in Hardy-Weinberg equilibrium for both polymorphisms. The frequency of mutations was significant and the presence of related vaso-occlusive events was more common in patients with Hb SS (p = 0007). The 844ins68 mutation was approximately three times more frequent in patients with vaso-occlusive complications (p = 0011). The C677T mutation did not prove to be associated with risk of vaso-occlusive events (p = 0.193). A C677T-844ins68 interaction occurred in 12.08% of the patients, doubling the risk of vaso-occlusive manifestations. The frequencies of the polymorphisms are consistent with those expected in the Brazilian population. The presence of the 844ins68 mutation of the CBS gene proved to be a potential risk factor for vaso-occlusive events in sickle cell patients.

Dornase alfa improves the health-related quality of life among Brazilian patients with cystic fibrosis - A one-year prospective study

Background: Health-related quality of life (HRQOL) measurements provide valuable information about the psychological and social impact of treatment on patients with cystic fibrosis (CF). This study evaluated the HRQOL of Brazilian patients with CF and assessed the changes in HRQOL domains over 1 year after dornase alfa (Pulmozyme) introduction. Patients and Methods: One hundred fifty-six stable patients with CF and 89 caregivers answered the Portuguese-validated version of the Cystic Fibrosis Questionnaire-Revised (CFQ-R) at baseline (T 0), and at 3 (T 1), 6 (T 2), 9 (T 3), and 12 (T 4) months of follow-up. Eighteen patientswere excluded because they did not fulfill the inclusion criteria. The patients were analyzed in two groups: those aged 6-11 years and those aged 14 years and older. ANOVA for observed repeated results and the last observation carried forward (LOCF) method for missing data were used for the statistical analysis. Results: After 1 year of follow-up, there was significant improvement in respiratory symptoms (T 4-T 0=8.1; 95% confidence interval (95% CI)=[2.1;14.0]; effect size (ES)=0.35; P<0.001), Emotional Functioning (T 4-T 0=5.6; 95% CI=[1.1;10.1]; ES=0.31; P<0.05), Social Functioning (T 4-T 0=6.0; 95% CI=[1.3;11.7]; ES=0.31; P<0.05), Body Image (T 4-T 0=11.9; 95% CI=[4.1;19.7]; ES=0.42; P<0.05), and Treatment Burden (T 4-T 0=5.3; 95% CI=[0.3;10.3]; ES=0.24; P<0.05) domains in the younger group. A significant improvement in Role Functioning (T 4-T 0=6.1; 95% CI=[1.1;11.1]; ES=0.40; P<0.05), Body Image (T 4-T 0=12.6; 95% CI=[3.5;21.7]; ES=0.46; P<0.05), and Weight (T 4-T 0=11.7; 95% CI=[1.8;21.6]; ES=0.40; P<0.05) was obtained in the older group. The caregivers' CFQ-R showed improvements in the Digestive Symptoms (T 4-T 0=5.5; 95% CI=[1.5;9.4]; ES=0.30; P<0.05), Respiratory Symptoms (T 4-T 0=7.6; 95% CI=[3.9;11.4]; ES=0.48; P<0.05), and Weight (T 4-T 0=10.1; 95% CI=[1.6;18.6]; ES=0.26; P<0.05) domains. Conclusion: The introduction of dornase alfa improved the HRQL of the patients with CF during the first year of treatment. © 2010 Wiley-Liss, Inc.

O papel das argininas alfa-92 e alfa-141 na regulação das propriedades funcionais de hemoglobinas por íons cloreto

The oxygenation of human Hb (HbA) demands a three state model: two deoxy states To and Tx, free and complexed with anions respectively, and an oxy R state. The regulation between these states is modulated by the presence of anions, such as chloride, that binds to T state. The b inding if chloride, however, remains controversial. The aim of this work is the study of arginines 92a (a1ß2 interface) and 141a (C-terminal) as chloride binding sites. To investigate that, we have studied 92 and 141 site directed mutant species: natural mutants Hb J-Cape-Town (R92Q), desArg (R141Δ), Chesapeake (R92L), and the constructed Chesapeake desArg (R92L,141Δ). We expressed Hbs in Escherichia coli and purified. Through oxygen binding curves we measured affinity and cooperativity, in function of water effect and Bohr effect in presence and absence of chloride. Structural features were obtained through 1H NMR spectroscopy Oxygen binding properties and Bohr effect measured indicated a higher affinity and lower cooperativity in absence and presence of chloride for all mutants. Structural changes represent functional aspects of mutant Hbs, such as a significant rise in affinity or a change in cooperativity. Water activity studies conducted as a function of chloride concentration showed that the only Hb desArg follows the thre state model. The other mutant Hbs do not exhibit the Tx state, a fact confirmed by the number of water molecules bound to each Hb during the deoxy-oxy transition. This behavior suggests that the Arginine 92 site could be responsible for chloride binding to Hb, since oxygenation of 92 mutant Hbs cannot be adjusted by the three state model. However, Bohr effect showed that all mutant Hbs released~1 proton in chloride presence, different from HbA that releases ~2, suggesting a role for 141 arginine in the tertiary and quaternary Bohr effect.

Participação da via alfa-2 adrenérgica no controle da secreção do hormônio do crescimento no período prépúbere em novilhas da raça Nelore

This study investigated GH secretion after clonidine (alpha-2 adrenergic agonist) treatment in pre-pubertal Nelore heifers. Clonidine (10 mg/kg, IV, 15 min samples for 4 h) was administrated in the same Nelore heifers at eight (n = 4), 12 (n = 5) and 15 (n = 4) months of age. The GH concentration was measured by radioimmunoassay (sensivity = 0.25 ng/mL, CV = 16%). At eight months, clonidine increased GH average concentration, total area of peaks, the total area of GH secretion and increased peak amplitude and reduced time to onset of peak (P < 0.05). At 15 months, the administration of clonidine increased the GH average concentration and at 12 months the increased occurred only in restricted intervals (P < 0.05). Clonidine injection stimulated GH secretion in prepubertal heifers and this effect was more evident in Nelore heifers at eight months compared to 12 and 15 months of age.

Efeito do treinamento físico sobre aspectos metabólicos e endócrinos de ratos wistar administrados com testosterona

Pós-graduação em Ciências da Motricidade - IBRC

Implante de cimento de alfa-fosfato tricálcico de dupla pega munido de canais de interconexão em órbita de coelhos

Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)

Eritrograma glutationa reduzida e superóxido dismutase eritrocitários e metahemoglobina em equinos da raça Árabe submetidos a exercício em esteira: efeito da suplementação com vitamina E (dl-alfa-tocoferol)

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)