999 resultados para Plane Detection
Resumo:
Recent advances in airborne Light Detection and Ranging (LIDAR) technology allow rapid and inexpensive measurements of topography over large areas. Airborne LIDAR systems usually return a 3-dimensional cloud of point measurements from reflective objects scanned by the laser beneath the flight path. This technology is becoming a primary method for extracting information of different kinds of geometrical objects, such as high-resolution digital terrain models (DTMs), buildings and trees, etc. In the past decade, LIDAR gets more and more interest from researchers in the field of remote sensing and GIS. Compared to the traditional data sources, such as aerial photography and satellite images, LIDAR measurements are not influenced by sun shadow and relief displacement. However, voluminous data pose a new challenge for automated extraction the geometrical information from LIDAR measurements because many raster image processing techniques cannot be directly applied to irregularly spaced LIDAR points. ^ In this dissertation, a framework is proposed to filter out information about different kinds of geometrical objects, such as terrain and buildings from LIDAR automatically. They are essential to numerous applications such as flood modeling, landslide prediction and hurricane animation. The framework consists of several intuitive algorithms. Firstly, a progressive morphological filter was developed to detect non-ground LIDAR measurements. By gradually increasing the window size and elevation difference threshold of the filter, the measurements of vehicles, vegetation, and buildings are removed, while ground data are preserved. Then, building measurements are identified from no-ground measurements using a region growing algorithm based on the plane-fitting technique. Raw footprints for segmented building measurements are derived by connecting boundary points and are further simplified and adjusted by several proposed operations to remove noise, which is caused by irregularly spaced LIDAR measurements. To reconstruct 3D building models, the raw 2D topology of each building is first extracted and then further adjusted. Since the adjusting operations for simple building models do not work well on 2D topology, 2D snake algorithm is proposed to adjust 2D topology. The 2D snake algorithm consists of newly defined energy functions for topology adjusting and a linear algorithm to find the minimal energy value of 2D snake problems. Data sets from urbanized areas including large institutional, commercial, and small residential buildings were employed to test the proposed framework. The results demonstrated that the proposed framework achieves a very good performance. ^
Resumo:
Biochemical agents, including bacteria and toxins, are potentially dangerous and responsible for a wide variety of diseases. Reliable detection and characterization of small samples is necessary in order to reduce and eliminate their harmful consequences. Microcantilever sensors offer a potential alternative to the state of the art due to their small size, fast response time, and the ability to operate in air and liquid environments. At present, there are several technology limitations that inhibit application of microcantilever to biochemical detection and analysis, including difficulties in conducting temperature-sensitive experiments, material inadequacy resulting in insufficient cell capture, and poor selectivity of multiple analytes. This work aims to address several of these issues by introducing microcantilevers having integrated thermal functionality and by introducing nanocrystalline diamond as new material for microcantilevers. Microcantilevers are designed, fabricated, characterized, and used for capture and detection of cells and bacteria. The first microcantilever type described in this work is a silicon cantilever having highly uniform in-plane temperature distribution. The goal is to have 100 μm square uniformly heated area that can be used for thermal characterization of films as well as to conduct chemical reactions with small amounts of material. Fabricated cantilevers can reach above 300C while maintaining temperature uniformity of 2−4%. This is an improvement of over one order of magnitude over currently available cantilevers. The second microcantilever type is a doped single crystal silicon cantilever having a thin coating of ultrananocrystalline diamond (UNCD). The primary application of such a device is in biological testing, where diamond acts as a stable, electrically isolated reaction surface while silicon layer provides controlled heating with minimum variations in temperature. This work shows that composite cantilevers of this kind are an effective platform for temperature-sensitive biological experiments, such as heat lysing and polymerase chain reaction. The rapid heat-transfer of Si-UNCD cantilever compromised the membrane of NIH 3T3 fibroblast and lysed the cell nucleus within 30 seconds. Bacteria cells, Listeria monocytogenes V7, were shown to be captured with biotinylated heat-shock protein on UNCD surface and 90% of all viable cells exhibit membrane porosity due to high heat in 15 seconds. Lastly, a sensor made solely from UNCD diamond is fabricated with the intention of being used to detect the presence of biological species by means of an integrated piezoresistor or through frequency change monitoring. Since UNCD diamond has not been previously used in piezoresistive applications, temperature-denpendent piezoresistive coefficients and gage factors are determined first. The doped UNCD exhibits a significant piezoresistive effect with gauge factor of 7.53±0.32 and a piezoresistive coefficient of 8.12×10^−12 Pa^−1 at room temperature. The piezoresistive properties of UNCD are constant over the temperature range of 25−200C. 300 μm long cantilevers have the highest sensitivity of 0.186 m-Ohm/Ohm per μm of cantilever end deflection, which is approximately half that of similarly sized silicon cantilevers. UNCD cantilever arrays were fabricated consisting of four sixteen-cantilever arrays of length 20–90 μm in addition to an eight-cantilever array of length 120 μm. Laser doppler vibrometry (LDV) measured the cantilever resonant frequency, which ranged as 218 kHz−5.14 MHz in air and 73 kHz−3.68 MHz in water. The quality factor of the cantilever was 47−151 in air and 18−45 in water. The ability to measure frequencies of the cantilever arrays opens the possibility for detection of individual bacteria by monitoring frequency shift after cell capture.
Resumo:
One of the most exciting discoveries in astrophysics of the last last decade is of the sheer diversity of planetary systems. These include "hot Jupiters", giant planets so close to their host stars that they orbit once every few days; "Super-Earths", planets with sizes intermediate to those of Earth and Neptune, of which no analogs exist in our own solar system; multi-planet systems with planets smaller than Mars to larger than Jupiter; planets orbiting binary stars; free-floating planets flying through the emptiness of space without any star; even planets orbiting pulsars. Despite these remarkable discoveries, the field is still young, and there are many areas about which precious little is known. In particular, we don't know the planets orbiting Sun-like stars nearest to our own solar system, and we know very little about the compositions of extrasolar planets. This thesis provides developments in those directions, through two instrumentation projects.
The first chapter of this thesis concerns detecting planets in the Solar neighborhood using precision stellar radial velocities, also known as the Doppler technique. We present an analysis determining the most efficient way to detect planets considering factors such as spectral type, wavelengths of observation, spectrograph resolution, observing time, and instrumental sensitivity. We show that G and K dwarfs observed at 400-600 nm are the best targets for surveys complete down to a given planet mass and out to a specified orbital period. Overall we find that M dwarfs observed at 700-800 nm are the best targets for habitable-zone planets, particularly when including the effects of systematic noise floors caused by instrumental imperfections. Somewhat surprisingly, we demonstrate that a modestly sized observatory, with a dedicated observing program, is up to the task of discovering such planets.
We present just such an observatory in the second chapter, called the "MINiature Exoplanet Radial Velocity Array," or MINERVA. We describe the design, which uses a novel multi-aperture approach to increase stability and performance through lower system etendue, as well as keeping costs and time to deployment down. We present calculations of the expected planet yield, and data showing the system performance from our testing and development of the system at Caltech's campus. We also present the motivation, design, and performance of a fiber coupling system for the array, critical for efficiently and reliably bringing light from the telescopes to the spectrograph. We finish by presenting the current status of MINERVA, operational at Mt. Hopkins observatory in Arizona.
The second part of this thesis concerns a very different method of planet detection, direct imaging, which involves discovery and characterization of planets by collecting and analyzing their light. Directly analyzing planetary light is the most promising way to study their atmospheres, formation histories, and compositions. Direct imaging is extremely challenging, as it requires a high performance adaptive optics system to unblur the point-spread function of the parent star through the atmosphere, a coronagraph to suppress stellar diffraction, and image post-processing to remove non-common path "speckle" aberrations that can overwhelm any planetary companions.
To this end, we present the "Stellar Double Coronagraph," or SDC, a flexible coronagraphic platform for use with the 200" Hale telescope. It has two focal and pupil planes, allowing for a number of different observing modes, including multiple vortex phase masks in series for improved contrast and inner working angle behind the obscured aperture of the telescope. We present the motivation, design, performance, and data reduction pipeline of the instrument. In the following chapter, we present some early science results, including the first image of a companion to the star delta Andromeda, which had been previously hypothesized but never seen.
A further chapter presents a wavefront control code developed for the instrument, using the technique of "speckle nulling," which can remove optical aberrations from the system using the deformable mirror of the adaptive optics system. This code allows for improved contrast and inner working angles, and was written in a modular style so as to be portable to other high contrast imaging platforms. We present its performance on optical, near-infrared, and thermal infrared instruments on the Palomar and Keck telescopes, showing how it can improve contrasts by a factor of a few in less than ten iterations.
One of the large challenges in direct imaging is sensing and correcting the electric field in the focal plane to remove scattered light that can be much brighter than any planets. In the last chapter, we present a new method of focal-plane wavefront sensing, combining a coronagraph with a simple phase-shifting interferometer. We present its design and implementation on the Stellar Double Coronagraph, demonstrating its ability to create regions of high contrast by measuring and correcting for optical aberrations in the focal plane. Finally, we derive how it is possible to use the same hardware to distinguish companions from speckle errors using the principles of optical coherence. We present results observing the brown dwarf HD 49197b, demonstrating the ability to detect it despite it being buried in the speckle noise floor. We believe this is the first detection of a substellar companion using the coherence properties of light.
Resumo:
To assess binocular detection grating acuity using the LEA GRATINGS test to establish age-related norms in healthy infants during their first 3 months of life. In this prospective, longitudinal study of healthy infants with clear red reflex at birth, responses to gratings were measured at 1, 2, and 3 months of age using LEA gratings at a distance of 28 cm. The results were recorded as detection grating acuity values, which were arranged in frequency tables and converted to a one-octave scale for statistical analysis. For the repeated measurements, analysis of variance (ANOVA) was used to compare the detection grating acuity results between ages. A total of 133 infants were included. The binocular responses to gratings showed development toward higher mean values and spatial frequencies, ranging from 0.55 ± 0.70 cycles per degree (cpd), or 1.74 ± 0.21 logMAR, in month 1 to 3.11 ± 0.54 cpd, or 0.98 ± 0.16 logMAR, in month 3. Repeated ANOVA indicated differences among grating acuity values in the three age groups. The LEA GRATINGS test allowed assessment of detection grating acuity and its development in a cohort of healthy infants during their first 3 months of life.
Resumo:
A novel capillary electrophoresis method using capacitively coupled contactless conductivity detection is proposed for the determination of the biocide tetrakis(hydroxymethyl)phosphonium sulfate. The feasibility of the electrophoretic separation of this biocide was attributed to the formation of an anionic complex between the biocide and borate ions in the background electrolyte. Evidence of this complex formation was provided by (11) B NMR spectroscopy. A linear relationship (R(2) = 0.9990) between the peak area of the complex and the biocide concentration (50-900 μmol/L) was found. The limit of detection and limit of quantification were 15.0 and 50.1 μmol/L, respectively. The proposed method was applied to the determination of tetrakis(hydroxymethyl)phosphonium sulfate in commercial formulations, and the results were in good agreement with those obtained by the standard iodometric titration method. The method was also evaluated for the analysis of tap water and cooling water samples treated with the biocide. The results of the recovery tests at three concentration levels (300, 400, and 600 μmol/L) varied from 75 to 99%, with a relative standard deviation no higher than 9%.
Resumo:
Infections of the central nervous systems (CNS) present a diagnostic problem for which an accurate laboratory diagnosis is essential. Invasive practices, such as cerebral biopsy, have been replaced by obtaining a polymerase chain reaction (PCR) diagnosis using cerebral spinal fluid (CSF) as a reference method. Tests on DNA extracted from plasma are noninvasive, thus avoiding all of the collateral effects and patient risks associated with CSF collection. This study aimed to determine whether plasma can replace CSF in nested PCR analysis for the detection of CNS human herpesvirus (HHV) diseases by analysing the proportion of patients whose CSF nested PCR results were positive for CNS HHV who also had the same organism identified by plasma nested PCR. In this study, CSF DNA was used as the gold standard, and nested PCR was performed on both types of samples. Fifty-two patients with symptoms of nervous system infection were submitted to CSF and blood collection. For the eight HHV, one positive DNA result-in plasma and/or CSF nested PCR-was considered an active HHV infection, whereas the occurrence of two or more HHVs in the same sample was considered a coinfection. HHV infections were positively detected in 27/52 (51.9%) of the CSF and in 32/52 (61.5%) of the plasma, difference not significant, thus nested PCR can be performed on plasma instead of CSF. In conclusion, this findings suggest that plasma as a useful material for the diagnosis of cases where there is any difficulty to perform a CSF puncture.
Resumo:
The aim of this study was to develop a methodology using Raman hyperspectral imaging and chemometric methods for identification of pre- and post-blast explosive residues on banknote surfaces. The explosives studied were of military, commercial and propellant uses. After the acquisition of the hyperspectral imaging, independent component analysis (ICA) was applied to extract the pure spectra and the distribution of the corresponding image constituents. The performance of the methodology was evaluated by the explained variance and the lack of fit of the models, by comparing the ICA recovered spectra with the reference spectra using correlation coefficients and by the presence of rotational ambiguity in the ICA solutions. The methodology was applied to forensic samples to solve an automated teller machine explosion case. Independent component analysis proved to be a suitable method of resolving curves, achieving equivalent performance with the multivariate curve resolution with alternating least squares (MCR-ALS) method. At low concentrations, MCR-ALS presents some limitations, as it did not provide the correct solution. The detection limit of the methodology presented in this study was 50μgcm(-2).
Resumo:
A rapid and low cost method to determine Cr(VI) in soils based upon alkaline metal extraction at room temperature is proposed as a semi-quantitative procedure to be performed in the field. A color comparison with standards with contents of Cr(VI) in the range of 10 to 150 mg kg-1 was used throughout. For the different types of soils studied, more than 75% of the fortified soluble Cr(VI) were recovered for all levels of spike tested for both the proposed and standard methods. Recoveries of 83 and 99% were obtained for the proposed and the standard methods, respectively, taking into account the analysis of a heavily contaminated soil sample.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.
Resumo:
Conventional radiography has shown limitation in acquiring image of the ATM region, thus, computed tomography (CT) scanning has been the best option to the present date for diagnosis, surgical planning and treatment of bone lesions, owing to its specific properties. OBJECTIVE: The aim of the study was to evaluate images of simulated bone lesions at the head of the mandible by multislice CT. MATERIAL AND METHODS: Spherical lesions were made with dental spherical drills (sizes 1, 3, and 6) and were evaluated by using multislice CT (64 rows), by two observers in two different occasions, deploying two protocols: axial, coronal, and sagittal images, and parasagittal images for pole visualization (anterior, lateral, posterior, medial and superior). Acquired images were then compared with those lesions in the dry mandible (gold standard) to evaluate the specificity and sensibility of both protocols. Statistical methods included: Kappa statistics, validity test and chi-square test. Results demonstrated the advantage of associating axial, coronal, and sagittal slices with parasagittal slices for lesion detection at the head of the mandible. RESULTS: There was no statistically significant difference between the types of protocols regarding a particular localization of lesions at the poles. CONCLUSIONS: Protocols for the assessment of the head of the mandible were established to improve the visualization of alterations of each of the poles of the mandible's head. The anterior and posterior poles were better visualized in lateral-medial planes while lateral, medial and superior poles were better visualized in the anterior-posterior plane.
Resumo:
Previous studies indicated that patients with atherosclerosis are predominantly infected by human cytomegalovirus (HCMV), but rarely infected by type 1 Epstein-Barr virus (EBV-1). In this study, atheromas of 30 patients who underwent aortocoronary bypass surgery with coronary endartherectomy were tested for the presence of these two viruses. HCMV occurred in 93.3% of the samples and EBV-1 was present in 50% of them. Concurrent presence of both pathogens was detected in 43.3% of the samples.
Resumo:
Secondary caries has been reported as the main reason for restoration replacement. The aim of this in vitro study was to evaluate the performance of different methods - visual inspection, laser fluorescence (DIAGNOdent), radiography and tactile examination - for secondary caries detection in primary molars restored with amalgam. Fifty-four primary molars were photographed and 73 suspect sites adjacent to amalgam restorations were selected. Two examiners evaluated independently these sites using all methods. Agreement between examiners was assessed by the Kappa test. To validate the methods, a caries-detector dye was used after restoration removal. The best cut-off points for the sample were found by a Receiver Operator Characteristic (ROC) analysis, and the area under the ROC curve (Az), and the sensitivity, specificity and accuracy of the methods were calculated for enamel (D2) and dentine (D3) thresholds. These parameters were found for each method and then compared by the McNemar test. The tactile examination and visual inspection presented the highest inter-examiner agreement for the D2 and D3 thresholds, respectively. The visual inspection also showed better performance than the other methods for both thresholds (Az = 0.861 and Az = 0.841, respectively). In conclusion, the visual inspection presented the best performance for detecting enamel and dentin secondary caries in primary teeth restored with amalgam.
Resumo:
Onion (Allium cepa) is one of the most cultivated and consumed vegetables in Brazil and its importance is due to the large laborforce involved. One of the main pests that affect this crop is the Onion Thrips (Thrips tabaci), but the spatial distribution of this insect, although important, has not been considered in crop management recommendations, experimental planning or sampling procedures. Our purpose here is to consider statistical tools to detect and model spatial patterns of the occurrence of the onion thrips. In order to characterize the spatial distribution pattern of the Onion Thrips a survey was carried out to record the number of insects in each development phase on onion plant leaves, on different dates and sample locations, in four rural properties with neighboring farms under different infestation levels and planting methods. The Mantel randomization test proved to be a useful tool to test for spatial correlation which, when detected, was described by a mixed spatial Poisson model with a geostatistical random component and parameters allowing for a characterization of the spatial pattern, as well as the production of prediction maps of susceptibility to levels of infestation throughout the area.
Resumo:
To determine the presence of Brucella ovis in ovine from Paraíba State, in the Northeast region of Brazil, 80 animals slaughtered in the public slaughterhouse of Patos city were used. Before slaughter, blood samples were collected by jugular venopuncture from each animal, and after slaughter, testicles, epidydimus and uterus were aseptically collected. For the serological diagnosis of B. ovis and B. abortus infections, the agar gel immunodiffusion (AGID) and Rose Bengal (RBT) tests were carried out, respectively. In addition, microbiological culture and polymerase chain reaction (PCR) were performed on testicle, epidydimus and uterus samples. Six animals (7.5%) tested positive for the presence of B. ovis antibodies and all animals tested negative for the presence of B. abortus antibodies. One AGID-positive animal tested positive at uterine swab culture. PCR was able to amplify DNA of Brucella spp. from the pool of testicle, epidydimus and uterus samples from AGID-positive animals. This is the first report of isolation and detection of B. ovis DNA by PCR in ovine from the Northeast region of Brazil.
Resumo:
The objective of the present study was to improve the detection of B. abortus by PCR in organs of aborted fetuses from infected cows, an important mechanism to find infected herds on the eradication phase of the program. So, different DNA extraction protocols were compared, focusing the PCR detection of B. abortus in clinical samples collected from aborted fetuses or calves born from cows challenged with the 2308 B. abortus strain. Therefore, two gold standard groups were built based on classical bacteriology, formed from: 32 lungs (17 positives), 26 spleens (11 positives), 23 livers (8 positives) and 22 bronchial lymph nodes (7 positives). All samples were submitted to three DNA extraction protocols, followed by the same amplification process with the primers B4 and B5. From the accumulated results for organ, the proportion of positives for the lungs was higher than the livers (p=0.04) or bronchial lymph nodes (p=0.004) and equal to the spleens (p=0.18). From the accumulated results for DNA extraction protocol, the proportion of positives for the Boom protocol was bigger than the PK (p<0.0001) and GT (p=0.0004). There was no difference between the PK and GT protocols (p=0.5). Some positive samples from the classical bacteriology were negative to the PCR and viceversa. Therefore, the best strategy for B. abortus detection in the organs of aborted fetuses or calves born from infected cows is the use, in parallel, of isolation by classical bacteriology and the PCR, with the DNA extraction performed by the Boom protocol.