Prevalence and risk-factor analysis of Shiga toxigenic Escherichia coli in faecal samples of organically and conventionally farmed dairy cattle

Cattle are a natural reservoir for Shiga toxigenic Escherichia coli (STEC), however, no data are available on the prevalence and their possible association with organic or conventional farming practices. We have therefore studied the prevalence of STEC and specifically O157:H7 in Swiss dairy cattle by collecting faeces from approximately 500 cows from 60 farms with organic production (OP) and 60 farms with integrated (conventional) production (IP). IP farms were matched to OP farms and were comparable in terms of community, agricultural zone, and number of cows per farm. E. coli were grown overnight in an enrichment medium, followed by DNA isolation and PCR analysis using specific TaqMan assays. STEC were detected in all farms and O157:H7 were present in 25% of OP farms and 17% of IP farms. STEC were detected in 58% and O157:H7 were evidenced in 4.6% of individual faeces. Multivariate statistical analyses of over 250 parameters revealed several risk-factors for the presence of STEC and O157:H7. Risk-factors were mainly related to the potential of cross-contamination of feeds and cross-infection of cows, and age of the animals. In general, no significant differences between the two farm types concerning prevalence or risk for carrying STEC or O157:H7 were observed. Because the incidence of human disease caused by STEC in Switzerland is low, the risk that people to get infected appears to be small despite a relatively high prevalence in cattle. Nevertheless, control and prevention practices are indicated to avoid contamination of animal products.

RNA-Seq-based analysis of the physiologic cold shock-induced changes in Moraxella catarrhalis gene expression

BACKGROUND Moraxella catarrhalis, a major nasopharyngeal pathogen of the human respiratory tract, is exposed to rapid downshifts of environmental temperature when humans breathe cold air. The prevalence of pharyngeal colonization and respiratory tract infections caused by M. catarrhalis is greatest in winter. We investigated how M. catarrhalis uses the physiologic exposure to cold air to regulate pivotal survival systems that may contribute to M. catarrhalis virulence. RESULTS In this study we used the RNA-seq techniques to quantitatively catalogue the transcriptome of M. catarrhalis exposed to a 26 °C cold shock or to continuous growth at 37 °C. Validation of RNA-seq data using quantitative RT-PCR analysis demonstrated the RNA-seq results to be highly reliable. We observed that a 26 °C cold shock induces the expression of genes that in other bacteria have been related to virulence a strong induction was observed for genes involved in high affinity phosphate transport and iron acquisition, indicating that M. catarrhalis makes a better use of both phosphate and iron resources after exposure to cold shock. We detected the induction of genes involved in nitrogen metabolism, as well as several outer membrane proteins, including ompA, m35-like porin and multidrug efflux pump (acrAB) indicating that M. catarrhalis remodels its membrane components in response to downshift of temperature. Furthermore, we demonstrate that a 26 °C cold shock enhances the induction of genes encoding the type IV pili that are essential for natural transformation, and increases the genetic competence of M. catarrhalis, which may facilitate the rapid spread and acquisition of novel virulence-associated genes. CONCLUSION Cold shock at a physiologically relevant temperature of 26 °C induces in M. catarrhalis a complex of adaptive mechanisms that could convey novel pathogenic functions and may contribute to enhanced colonization and virulence.

Molecular differentiation by PCR-RFLP technique shows that Antarctic fishes of the genus Notothenia, claimed to be two species, are phenotypic varieties with the same genetic pattern (Table 1)

The taxonomy of Antarctic fishes has been predominantly based on morphological characteristics rather than on genetic criteria. A typical example is the Notothenia group, which includes N. coriiceps Richardson, 1844, N. neglecta Nybelin, 1951 and N. rossii Richardson, 1844. The Polymerase Chain Reaction and Restriction Fragment Length Polymorphism (PCR-RFLP) technique was used to determine whether N. coriiceps Richardson, 1844 and N. neglecta Nybelin, 1951 are different or whether they are the same species with morphological, physiological and behavioural variability. N. rossii was used as control. Mitochondrial DNA (mtDNA) was isolated from muscle specimens of N. coriiceps Richardson, 1844, N. neglecta Nybelin, 1951 and N. rossii, which were collected in Admiralty Bay, King George Island. The DNA was used to amplify a fragment (690 base pairs) of the mitochondrial gene coding region of NADH dehydrogenase subunit 2. Further, the amplicon was digested with the following restriction enzymes: DdeI, HindIII and RsaI. The results showed a variation of the digestion pattern of the fragment amplified between N. rossii, and N. coriiceps Richardson, 1844 or N. neglecta Nybelin, 1951. However, no differences were found between N. coriiceps Richardson, 1844 and N. neglecta Nybelin, 1951, on the grounds of the same genetic pattern shown by the two fish.

Ladderane lipid analysis and pore water and sediment chemistry of sediment cores from the continental shelf and slope off northwest Africa

The presence and abundance of anaerobic ammonium-oxidizing (anammox) bacteria was investigated in continental shelf and slope sediments (300-3000 m water depth) off northwest Africa in a combined approach applying quantitative polymerase chain reaction (q-PCR) analysis of anammox-specific 16S rRNA genes and anammox-specific ladderane biomarker lipids. We used the presence of an intact ladderane monoether lipid with a phosphocholine (PC) headgroup as a direct indicator for living anammox bacteria and compared it with the abundance of ladderane core lipids derived from both living and dead bacterial biomass. All investigated sediments contained ladderane lipids, both intact and core lipids, in agreement with the presence of anammoxspecific 16S rRNA gene copies, indicating that anammox occurs at all sites. Concentrations of ladderane core lipids in core top sediments varied between 0.3 and 97 ng g**-1 sediment, with the highest concentrations detected at the sites located on the shelf at shallower water depths between 300 and 500 m. In contrast, the C20 [3]-ladderane monoether-PC lipid was most abundant in a core top sediment from 1500 m water depth. Both anammox-specific 16S rRNA gene copy numbers and the concentration of the C20 [3]-ladderane monoether-PC lipid increased downcore in sediments located at greater water depths, showing highest concentrations of 1.2 x 10**8 copies g**-1 sediment and 30 pg g**-1 sediment, respectively, at the deepest station of 3000 m water depth. This suggests that the relative abundance of anammox bacteria is higher in sediments at intermediate to deep water depths where carbon mineralization rates are lower but where anammox is probably more important than denitrification.

Panhandle PCR strategy to amplify MLL genomic breakpoints in treatment-related leukemias

Panhandle PCR amplifies genomic DNA with known 5′ and unknown 3′ sequences from a template with an intrastrand loop schematically shaped like a pan with a handle. We used panhandle PCR to clone MLL genomic breakpoints in two pediatric treatment-related leukemias. The karyotype in a case of treatment-related acute lymphoblastic leukemia showed the t(4;11)(q21;q23). Panhandle PCR amplified the translocation breakpoint at position 2158 in intron 6 in the 5′ MLL breakpoint cluster region (bcr). The karyotype in a case of treatment-related acute myeloid leukemia was normal, but Southern blot analysis showed a single MLL gene rearrangement. Panhandle PCR amplified the breakpoint at position 1493 in MLL intron 6. Screening of somatic cell hybrid and radiation hybrid DNAs by PCR and reverse transcriptase-PCR analysis of the leukemic cells indicated that panhandle PCR identified a fusion of MLL intron 6 with a previously uncharacterized sequence in MLL intron 1, consistent with a partial duplication. In both cases, the breakpoints in the MLL bcr were in Alu repeats, and there were Alu repeats in proximity to the breakpoints in the partner DNAs, suggesting that Alu sequences were relevant to these rearrangements. This study shows that panhandle PCR is an effective method for cloning MLL genomic breakpoints in treatment-related leukemias. Analysis of additional pediatric cases will determine whether breakpoint distribution deviates from the predilection for 3′ distribution in the bcr that has been found in adult cases.

High-resolution minisatellite-based typing as a portable approach to global analysis of Mycobacterium tuberculosis molecular epidemiology

The worldwide threat of tuberculosis to human health emphasizes the need to develop novel approaches to a global epidemiological surveillance. The current standard for Mycobacterium tuberculosis typing based on IS6110 restriction fragment length polymorphism (RFLP) suffers from the difficulty of comparing data between independent laboratories. Here, we propose a high-resolution typing method based on variable number tandem repeats (VNTRs) of genetic elements named mycobacterial interspersed repetitive units (MIRUs) in 12 human minisatellite-like regions of the M. tuberculosis genome. MIRU-VNTR profiles of 72 different M. tuberculosis isolates were established by PCR analysis of all 12 loci. From 2 to 8 MIRU-VNTR alleles were identified in the 12 regions in these strains, which corresponds to a potential of over 16 million different combinations, yielding a resolution power close to that of IS6110-RFLP. All epidemiologically related isolates tested were perfectly clustered by MIRU-VNTR typing, indicating that the stability of these MIRU-VNTRs is adequate to track outbreak episodes. The correlation between genetic relationships inferred from MIRU-VNTR and IS6110-RFLP typing was highly significant. Compared with IS6110-RFLP, high-resolution MIRU-VNTR typing has the considerable advantages of being fast, appropriate for all M. tuberculosis isolates, including strains that have a few IS6110 copies, and permitting easy and rapid comparison of results from independent laboratories. This typing method opens the way to the construction of digital global databases for molecular epidemiology studies of M. tuberculosis.

Detection sensitivity and quantitation of Plasmodium falciparum var gene transcripts by real-time RT-PCR in comparison with conventional RT-PCR

Antigenic variation in Plasmodium falciparum erythrocyte membrane protein 1, caused by a switch in transcription of the encoding var gene, is an important feature of malaria. In this study, we quantified the relative abundance of var gene transcripts present in P. falciparum parasite clones using real-time reverse transcription-polymerase chain reaction (RT-PCR) and conventional RT-PCR combined with cloning and sequencing, with the aim of directly comparing the results obtained. When there was sufficient abundance of RNA for the real-time RT-PCR assay to be operating within the region of good reproducibility, RT-PCR and real-time RT-PCR tended to identify the same dominant transcript, although some transcript-specific issues were identified. When there were differences in the estimated relative amounts of minor transcripts, the RT-PCR assay tended to produce higher estimates than real-time RT-PCR. These results provide valuable information comparing RT-PCR and real-time RT-PCR analysis of samples with small quantities of RNA as might be expected in the analysis of field or clinical samples.

Reconstruction and in silico analysis of the MAPK signaling pathways in the human blood fluke, Schistosoma japonicum

At present, little is known about signal transduction mechanisms in schistosomes, which cause the disease of schistosomiasis. The mitogen-activated protein kinase (MAPK) signaling pathways, which are evolutionarily conserved from yeast to Homo sapiens, play key roles in multiple cellular processes. Here, we reconstructed the hypothetical MAPK signaling pathways in Schistosoma japonicum and compared the schistosome pathways with those of model eukaryote species. We identified 60 homologous components in the S. japoncium MAPK signaling pathways. Among these, 27 were predicted to be full-length sequences. Phylogenetic analysis of these proteins confirmed the evolutionary conservation of the MAPK signaling pathways. Remarkably, we identified S. japonicum homologues of GTP-binding protein beta and alpha-I subunits in the yeast mating pathway, which might be involved in the regulation of different life stages and female sexual maturation processes as well in schistosomes. In addition, several pathway member genes, including ERK, JNK, Sja-DSP, MRAS and RAS, were determined through quantitative PCR analysis to be expressed in a stage-specific manner, with ERK, JNK and their inhibitor Sja-DSP markedly upregulated in adult female schistosomes. (c) 2006 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.

Identification, mutagenesis, and transcriptional analysis of the methanesulfonate transport operon of methylosulfonomonas methylovora

Recently identified genes located downstream (3') of the msmEF (transport encoding) gene cluster, msmGH, and located 5' of the structural genes for methanesulfonate monooxygenase (MSAMO) are described from Methylosulfonomonas methylovora. Sequence analysis of the derived polypeptide sequences encoded by these genes revealed a high degree of identity to ABC-type transporters. MsmE showed similarity to a putative periplasmic substrate binding protein, MsmF resembled an integral membraneassociated protein, and MsmG was a putative ATP-binding enzyme. MsmH was thought to be the cognate permease component of the sulfonate transport system. The close association of these putative transport genes to the MSAMO structural genes msmABCD suggested a role for these genes in transport of methanesulfonic acid (MSA) into M. methylovora. msmEFGH and msmABCD constituted two operons for the coordinated expression of MSAMO and the MSA transporter systems. Reverse-transcription-PCR analysis of msmABCD and msmEFGH revealed differential expression of these genes during growth on MSA and methanol. The msmEFGH operon was constitutively expressed, whereas MSA induced expression of msmABCD. A mutant defective in msmE had considerably slower growth rates than the wild type, thus supporting the proposed role of MsmE in the transport of MSA into M. methylovora.

Microarray analysis of expression of cell death-associated genes in spinal cord cells with cyclic tensile strain

Previous studies have described alterations in gene expression following spinal cord injury, but this response to mechanical stimuli is difficult to investigate in vivo. Therefore, we have investigated the effect of cyclic tensile strain on cultured spinal cord cells from E15 Sprague-Dawley rats. Microarray analysis of gene expression and categorization of identified genes were performed using Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) systems. The application of cyclic tensile strain reduced the viability of cultured spinal cord cells significantly in a dose- and time-dependent manner. GO analysis identified candidate genes related to apoptosis (44) and to response to stimulus (17). KEGG analysis identified changes in the expression levels of 12 genes of the mitogen-activated protein kinase (MAPK) signaling pathway, which were confirmed to be upregulated and validated by RT-PCR analysis. Spinal cord cells undergo cell death in response to cyclic tensile strain, which were dose- and time-dependent, with upregulation of various genes, in particular of the MAPK pathway.

Preimplantation genetic diagnosis: Analysis of gene expression, nuclear DNA and cytoplasmic DNA

Preimplantation genetic diagnosis (PGD) following in vitro fertilization (IVF) offers couples at risk for transmitting genetic disorders the opportunity to identify affected embryos prior to replacement. In particular, embryo gender determination permits screening for X-linked diseases of unknown etiology. Analysis of embryos can be performed by polymerase chain reaction (PCR) amplification of material obtained by micromanipulation. This approach provides an alternative to the termination of an established pregnancy following chorionic villi sampling or amniocentesis. ^ Lately, the focus of preimplantation diagnosis and intervention has been shifting toward an attempt to correct cytoplasmic deficiencies. Accordingly, it is the aim of this investigation to develop methods to permit the examination of single cells or components thereof for clinical evaluation. In an attempt to lay the groundwork for precise therapeutic intervention for age related aneuploidy, transcripts encoding proteins believed to be involved in the proper segregation of chromosomes during human oocyte maturation were examined and quantified. Following fluorescent rapid cycle RT-PCR analysis it was determined that the concentration of cell cycle checkpoint gene transcripts decreases significantly as maternal age increases. Given the well established link between increasing maternal age and the incidence of aneuploidy, these results suggest that the degradation of these messages in aging oocytes may be involved with inappropriate chromosome separation during meiosis. ^ In order to investigate the cause of embryonic rescue observed following clinical cytoplasmic transfer procedures and with the objective of developing a diagnostic tool, mtDNA concentrations in polar bodies and subcellular components were evaluated. First, the typical concentration of mtDNA in human and mouse oocytes was determined by fluorescent rapid cycle PCR. Some disparity was noted between the copy numbers of individual cytoplasmic samples which may limit the use of the current methodology for the clinical assessment of the corresponding oocyte. ^

Heteroduplex analysis of VDJ amplified segments from rearranged IgH genes for clonality assessments in B-cell non-Hodgkin's lymphoma. A comparison between different strategies.

BACKGROUND AND OBJECTIVE: The main difficulty of PCR-based clonality studies for B-cell lymphoproliferative disorders (B-LPD) is discrimination between monoclonal and polyclonal PCR products, especially when there is a high background of polyclonal B cells in the tumor sample. Actually, PCR-based methods for clonality assessment require additional analysis of the PCR products in order to discern between monoclonal and polyclonal samples. Heteroduplex analysis represents an attractive approach since it is easy to perform and avoids the use of radioactive substrates or expensive equipment. DESIGN AND METHODS: We studied the sensitivity and specificity of heteroduplex PCR analysis for monoclonal detection in samples from 90 B-cell non Hodgkin's lymphoma (B-NHL) patients and in 28 individuals without neoplastic B-cell disorders (negative controls). Furthermore, in 42 B-NHL and in the same 28 negative controls, we compared heteroduplex analysis vs the classical PCR technique. We also compared ethidium bromide (EtBr) vs. silver nitrate (AgNO(3)) staining as well as agarose vs. polyacrylamide gel electrophoresis (PAGE). RESULTS: Using two pair consensus primers sited at VH (FR3 and FR2) and at JH, 91% of B-NHL samples displayed monoclonal products after heteroduplex PCR analysis using PAGE and AgNO(3) staining. Moreover, no polyclonal sample showed a monoclonal PCR product. By contrast, false positive results were obtained when using agarose (5/28) and PAGE without heteroduplex analysis: 2/28 and 8/28 with EtBr and AgNO(3) staining, respectively. In addition, false negative results only appeared with EtBr staining: 13/42 in agarose, 4/42 in PAGE without heteroduplex analysis and 7/42 in PAGE after heteroduplex analysis. INTERPRETATION AND CONCLUSIONS: We conclude that AgNO(3) stained PAGE after heteroduplex analysis is the most suitable strategy for detecting monoclonal rearrangements in B-NHL samples because it does not produce false-positive results and the risk of false-negative results is very low.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Prevalence of ehrlichial infection among dogs and ticks in Northeastern Brazil

This study investigated the epidemiology of canine ehrlichiosis in Northeastern Brazil, focusing the identification of the Ehrlichia species and vectors involved. Samples were collected from 472 domestic dogs residing in the health districts of Cajazeiras and Itapuã of Salvador city. The average prevalence of antibodies reactive to E. canis by immunofluorescent antibody test (IFAT) (titer > 1:80) was 35.6% (168/472). Blood samples from the E. canis-seropositive animals were tested by nested PCR in order to identify the Ehrlichia species responsible for the infection. Among the seropositives, 58 (34.5%) were found to be PCR-positive for E. canis. Ticks were found in 32 dogs. Nested-PCR analysis showed that 21.9% (7/32) of the Rhipicephalus sanguineus were infected by E. canis. In both dogs and Rhipicephalus sanguineus, nested-PCR for E. ewingii and E. chaffeensis was negative, with no amplification of DNA fragment.

Hormone-regulated expression and distribution of versican in mouse uterine tissues

Background: Remodeling of the extracellular matrix is one of the most striking features observed in the uterus during the estrous cycle and after hormone replacement. Versican (VER) is a hyaluronan-binding proteoglycan that undergoes RNA alternative splicing, generating four distinct isoforms. This study analyzed the synthesis and distribution of VER in mouse uterine tissues during the estrous cycle, in ovariectomized (OVX) animals and after 17beta-estradiol (E2) and medroxyprogesterone (MPA) treatments, either alone or in combination. Methods: Uteri from mice in all phases of the estrous cycle, and animals subjected to ovariectomy and hormone replacement were collected for immunoperoxidase staining for versican, as well as PCR and quantitative Real Time PCR. Results: In diestrus and proestrus, VER was exclusively expressed in the endometrial stroma. In estrus and metaestrus, VER was present in both endometrial stroma and myometrium. In OVX mice, VER immunoreaction was abolished in all uterine tissues. VER expression was restored by E2, MPA and E2+MPA treatments. Real Time PCR analysis showed that VER expression increases considerably in the MPA-treated group. Analysis of mRNA identified isoforms V0, V1 and V3 in the mouse uterus. Conclusion: These results show that the expression of versican in uterine tissues is modulated by ovarian steroid hormones, in a tissue-specific manner. VER is induced in the myometrium exclusively by E2, whereas MPA induces VER deposition only in the endometrial stroma.