967 resultados para Non-target organism


Relevância:

100.00% 100.00%

Publicador:

Resumo:

Risk assessment guidelines for the environmental release of microbial agents are performed in a tiered sequence which includes evaluation of exposure effects on non target organisms. However, it becomes important to verify whether environmental risk assessment from temperate studies is applicable to tropical countries, as Brazil. Pseudomonas putida is a bacteria showing potential to be used for environmental applications as bioremediation and plant disease control. This study investigates the effects of this bacteria exposure on rodents and aquatic organisms (Daphnia similes) that are recommended to be used as non-target organism in environmental risk assessments. Also, the microbial activity in three different soils under P. putida exposure was evaluated. Rats did not show clinical alterations, although the agent was recovered 16 h after the exposure in lung homogenates. The bacteria did not reduce significantly the reproduction and survival of D. similis. The soil enzymatic activities presented fluctuating values after inoculation with bacteria. The measurement of perturbations in soil biochemical characteristics is presented as an alternative way of monitoring the overall effects of the microbial agent to be introduced even in first stage (Tier I) of the risk assessment in tropical ecosystems.

Relevância:

90.00% 90.00%

Publicador:

Resumo:

The diversity of endophytic filamentous fungi from leaves of transgenic imidazolinone-tolerant sugarcane plants and its isoline was evaluated by cultivation followed by amplified rDNA restriction analysis (ARDRA) of randomly selected strains. Transgenic and non-transgenic cultivars and their crop management (herbicide application or manual weed control) were used to assess the possible non-target effects of genetically modified sugarcane on the fungal endophytic community. A total of 14 ARDRA haplotypes were identified in the endophytic community of sugarcane. Internal transcribed spacer (ITS) sequencing revealed a rich community represented by 12 different families from the Ascomycota phylum. Some isolates had a high sequence similarity with genera that are common endophytes in tropical climates, such as Cladosporium, Epicoccum, Fusarium, Guignardia, Pestalotiopsis and Xylaria. Analysis of molecular variance indicated that fluctuations in fungal population were related to both transgenic plants and herbicide application. While herbicide applications quickly induced transient changes in the fungal community, transgenic plants induced slower changes that were maintained over time. These results represent the first draft on composition of endophytic filamentous fungi associated with sugarcane plants. They are an important step in understanding the possible effects of transgenic plants and their crop management on the fungal endophytic community.

Relevância:

90.00% 90.00%

Publicador:

Resumo:

This study aimed to evaluate, in controlled laboratory conditions (temperature of 25±2 °C, relative humidity of 60±10%, and 14/10 h L/D photoperiod), the larval development of Spodoptera eridania (Cramer, 1784) (Lepidoptera, Noctuidae) fed with leaves of Bt maize expressing Cry1F and Cry1F + Cry1A.105 + Cry2Ab2 insecticide proteins and its non-Btisoline. Maize leaves triggered 100% of mortality on S. eridania larvae independently of being Bt or non-Bt plants. However, it was observed that in overall Bt maize (expressing a single or pyramided protein) slightly affects the larval development of S. eridania, even under reduced leaf consumption. Therefore, these results showed that Cry1F and Cry1F + Cry1A.105 + Cry2Ab2 can affect the larval development of S. eridania, although it is not a target pest of this plant; however, more research is needed to better understand this evidence. Finally, this study confirms that non-Bt maize leaves are unsuitable food source to S. eridania larvae, suggesting that they are not a potential pest in maize fields.

Relevância:

90.00% 90.00%

Publicador:

Resumo:

The number of molecular diagnostic assays has increased tremendously in recent years.Nucleic acid diagnostic assays have been developed, especially for the detection of human pathogenic microbes and genetic markers predisposing to certain diseases. Closed-tube methods are preferred because they are usually faster and easier to perform than heterogenous methods and in addition, target nucleic acids are commonly amplified leading to risk of contamination of the following reactions by the amplification product if the reactions are opened. The present study introduces a new closed-tube switchable complementation probes based PCR assay concept where two non-fluorescent probes form a fluorescent lanthanide chelate complex in the presence of the target DNA. In this dual-probe PCR assay method one oligonucleotide probe carries a non-fluorescent lanthanide chelate and another probe a light absorbing antenna ligand. The fluorescent lanthanide chelate complex is formed only when the non-fluorescent probes are hybridized to adjacent positions into the target DNA bringing the reporter moieties in close proximity. The complex is formed by self-assembled lanthanide chelate complementation where the antenna ligand is coordinated to the lanthanide ion captured in the chelate. The complementation probes based assays with time-resolved fluorescence measurement showed low background signal level and hence, relatively high nucleic acid detection sensitivity (low picomolar target concentration). Different lanthanide chelate structures were explored and a new cyclic seven dentate lanthanide chelate was found suitable for complementation probe method. It was also found to resist relatively high PCR reaction temperatures, which was essential for the PCR assay applications. A seven-dentate chelate with two unoccupied coordination sites must be used instead of a more stable eight- or nine-dentate chelate because the antenna ligand needs to be coordinated to the free coordination sites of the lanthanide ion. The previously used linear seven-dentate lanthanide chelate was found to be unstable in PCR conditions and hence, the new cyclic chelate was needed. The complementation probe PCR assay method showed high signal-to-background ratio up to 300 due to a low background fluorescence level and the results (threshold cycles) in real-time PCR were reached approximately 6 amplification cycles earlier compared to the commonly used FRET-based closed-tube PCR method. The suitability of the complementation probe method for different nucleic acid assay applications was studied. 1) A duplex complementation probe C. trachomatis PCR assay with a simple 10-minute urine sample preparation was developed to study suitability of the method for clinical diagnostics. The performance of the C. trachomatis assay was equal to the commercial C. trachomatis nucleic acid amplification assay containing more complex sample preparation based on DNA extraction. 2) A PCR assay for the detection of HLA-DQA1*05 allele, that is used to predict the risk of type 1 diabetes, was developed to study the performance of the method in genotyping. A simple blood sample preparation was used where the nucleic acids were released from dried blood sample punches using high temperature and alkaline reaction conditions. The complementation probe HLA-DQA1*05 PCR assay showed good genotyping performance correlating 100% with the routinely used heterogenous reference assay. 3) To study the suitability of the complementation probe method for direct measurement of the target organism, e.g., in the culture media, the complementation probes were applied to amplificationfree closed-tube bacteriophage quantification by measuring M13 bacteriophage ssDNA. A low picomolar bacteriophage concentration was detected in a rapid 20- minute assay. The assay provides a quick and reliable alternative to the commonly used and relatively unreliable UV-photometry and time-consuming culture based bacteriophage detection methods and indicates that the method could also be used for direct measurement of other micro-organisms. The complementation probe PCR method has a low background signal level leading to a high signal-to-background ratio and relatively sensitive nucleic acid detection. The method is compatible with simple sample preparation and it was shown to tolerate residues of urine, blood, bacteria and bacterial culture media. The common trend in nucleic acid diagnostics is to create easy-to-use assays suitable for rapid near patient analysis. The complementation probe PCR assays with a brief sample preparation should be relatively easy to automate and hence, would allow the development of highperformance nucleic acid amplification assays with a short overall assay time.

Relevância:

90.00% 90.00%

Publicador:

Resumo:

BACKGROUND Little is known about native and non-native rodent species interactions in complex tropical agro-ecosystems. We hypothesised that the native non-pest rodent Rattus everetti may be competitively dominant over the invasive pest rodent Rattus tanezumi within agroforests. We tested this experimentally by using pulse removal for three consecutive months to reduce populations of R. everetti in agroforest habitat and assessed over 6-months the response of R. tanezumi and other rodent species. RESULTS Following removal, R. everetti individuals rapidly immigrated into removal sites. At the end of the study period, R. tanezumi were larger and there was a significant shift in their microhabitat use with respect to the use of ground vegetation cover following the perturbation of R. everetti. Irrespective of treatment, R. tanezumi selected microhabitat with less tree canopy cover, indicative of severely disturbed habitat, whereas, R. everetti selected microhabitat with a dense canopy. CONCLUSION Our results suggest that sustained habitat disturbance in agroforests favours R. tanezumi, whilst the regeneration of agroforests towards a more natural state would favour native species and may reduce pest pressure in adjacent crops. In addition, the rapid recolonisation of R. everetti suggests this species would be able to recover from non-target impacts of short-term rodent pest control.

Relevância:

90.00% 90.00%

Publicador:

Resumo:

Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)

Relevância:

90.00% 90.00%

Publicador:

Resumo:

Actualmente, la reducción de materias activas (UE) y la implantación de la nueva Directiva comunitaria 2009/128/ que establece el marco de actuación para conseguir un uso sostenible de los plaguicidas químicos y la preferencia de uso de métodos biológicos, físicos y otros no químicos, obliga a buscar métodos de control menos perjudiciales para el medio ambiente. El control biológico (CB) de enfermedades vegetales empleando agentes de control biológico (ACB) se percibe como una alternativa más segura y con menor impacto ambiental, bien solos o bien como parte de una estrategia de control integrado. El aislado 212 de Penicillium oxalicum (PO212) (ATCC 201888) fue aislado originalmente de la micoflora del suelo en España y ha demostrado ser un eficaz ACB frente a la marchitez vascular del tomate. Una vez identificado y caracterizado el ACB se inició el periodo de desarrollo del mismo poniendo a punto un método de producción en masa de sus conidias. Tras lo cual se inició el proceso de formulación del ACB deshidratando las conidias para su preservación durante un período de tiempo mayor mediante lecho fluido. Finalmente, se han desarrollado algunos formulados que contienen de forma individual diferentes aditivos que han alargado su viabilidad, estabilidad y facilitado su manejo y aplicación. Sin embargo, es necesario seguir trabajando en la mejora de su eficacia de biocontrol. El primer objetivo de esta Tesis se ha centrado en el estudio de la interacción ACB-patógeno-huésped que permita la actuación de P.oxalicum en diferentes patosistemas. Uno de los primeros puntos que se abordan dentro de este objetivo es el desarrollo de nuevas FORMULACIONES del ACB que incrementen su eficacia frente a la marchitez vascular del tomate. Las conidias formuladas de PO212 se obtuvieron por la adición conjunta de distintos aditivos (mojantes, adherentes o estabilizantes) en dos momentos diferentes del proceso de producción/secado: i) antes del proceso de producción (en la bolsa de fermentación) en el momento de la inoculación de las bolsas de fermentación con conidias de PO212 o ii) antes del secado en el momento de la resuspensión de las conidias tras su centrifugación. De las 22 nuevas formulaciones desarrolladas y evaluadas en plantas de tomate en ensayos en invernadero, seis de ellas (FOR22, FOR25, FOR32, FOR35, FOR36 y FOR37) mejoran significativamente (P=0,05) el control de la marchitez vascular del tomate con respecto al obtenido con las conidias secas de P.oxalicum sin aditivos (CSPO) o con el fungicida Bavistin. Los formulados que mejoran la eficacia de las conidias secas sin aditivos son aquellos que contienen como humectantes alginato sódico en fermentación, seguido de aquellos que contienen glicerol como estabilizante en fermentación, y metil celulosa y leche desnatada como adherentes antes del secado. Además, el control de la marchitez vascular del tomate por parte de los formulados de P. oxalicum está relacionado con la fecha de inicio de la enfermedad. Otra forma de continuar mejorando la eficacia de biocontrol es mejorar la materia activa mediante la SELECCIÓN DE NUEVAS CEPAS de P. oxalicum, las cuales podrían tener diferentes niveles de eficacia. De entre las 28 nuevas cepas de P. oxalicum ensayadas en cámara de cultivo, sólo el aislado PO15 muestra el mismo nivel de eficacia que PO212 (62-67% de control) frente a la marchitez vascular del tomate en casos de alta presión de enfermedad. Mientras que, en casos de baja presión de enfermedad todas las cepas de P. oxalicum y sus mezclas demuestran ser eficaces. Finalmente, se estudia ampliar el rango de actuación de este ACB a OTROS HUÉSPEDES Y OTROS PATÓGENOS Y DIFERENTES GRADOS DE VIRULENCIA. En ensayos de eficacia de P. oxalicum frente a aislados de diferente agresividad de Verticillium spp. y Fusarium oxysporum f. sp. lycopersici en plantas de tomate en cámaras de cultivo, se demuestra que la eficacia de PO212 está negativamente correlacionada con el nivel de enfermedad causada por F. oxysporum f. sp. lycopersici pero que no hay ningún efecto diferencial en la reducción de la incidencia ni de la gravedad según la virulencia de los aislados. Sin embargo, en los ensayos realizados con V. dahliae, PO212 causa una mayor reducción de la enfermedad en las plantas inoculadas con aislados de virulencia media. La eficacia de PO212 también era mayor frente a aislados de virulencia media alta de F. oxysporum f. sp. melonis y F. oxysporum f. sp. niveum, en plantas de melón y sandía, respectivamente. En ambos huéspedes se demuestra que la dosis óptima de aplicación del ACB es de 107 conidias de PO212 g-1 de suelo de semillero, aplicada 7 días antes del trasplante. Además, entre 2 y 4 nuevas aplicaciones de PO212 a la raíces de las plantas mediante un riego al terreno de asiento mejoran la eficacia de biocontrol. La eficacia de PO212 no se limita a hongos patógenos vasculares como los citados anteriormente, sino también a otros patógenos como: Phytophthora cactorum, Globodera pallida y G. rostochiensis. PO212 reduce significativamente los síntomas (50%) causados por P. cactorum en plantas de vivero de fresa, tras la aplicación del ACB por inmersión de las raíces antes de su trasplante al suelo de viveros comerciales. Por otra parte, la exposición de los quistes de Globodera pallida y G. rostochiensis (nematodos del quiste de la patata) a las conidias de P. oxalicum, en ensayos in vitro o en microcosmos de suelo, reduce significativamente la capacidad de eclosión de los huevos. Para G. pallida esta reducción es mayor cuando se emplean exudados de raíz de patata del cv. 'Monalisa', que exudados de raíz del cv. 'Desirée'. No hay una reducción significativa en la tasa de eclosión con exudados de raíz de tomate del cv. 'San Pedro'. Para G. rostochiensis la reducción en la tasa de eclosión de los huevos se obtiene con exudados de la raíz de patata del cv. 'Desirée'. El tratamiento con P. oxalicum reduce también significativamente el número de quistes de G. pallida en macetas. Con el fin de optimizar la aplicación práctica de P. oxalicum cepa 212 como tratamiento biológico del suelo, es esencial entender cómo el entorno físico influye en la capacidad de colonización, crecimiento y supervivencia del mismo, así como el posible riesgo que puede suponer su aplicación sobre el resto de los microorganismos del ecosistema. Por ello en este segundo objetivo de esta tesis se estudia la interacción del ACB con el medio ambiente en el cual se aplica. Dentro de este objetivo se evalúa la INFLUENCIA DE LA TEMPERATURA, DISPONIBILIDAD DE AGUA Y PROPIEDADES FÍSICO-QUÍMICAS DE LOS SUELOS (POROSIDAD, TEXTURA, DENSIDAD...) SOBRE LA SUPERVIVENCIA Y EL CRECIMIENTO DE PO212 en condiciones controladas elaborando modelos que permitan predecir el impacto de cada factor ambiental en la supervivencia y crecimiento de P. oxalicum y conocer su capacidad para crecer y sobrevivir en diferentes ambientes. En las muestras de suelo se cuantifica: i) la supervivencia de Penicillium spp. usando el recuento del número de unidades formadoras de colonias en un medio de cultivo semi-selectivo y ii) el crecimiento (biomasa) de PO212 mediante PCR en tiempo real. En los resultados obtenidos se demuestra que P. oxalicum crece y sobrevive mejor en condiciones de sequía independientemente de la temperatura y del tipo de suelo. Si comparamos tipos de suelo P. oxalicum crece y sobrevive en mayor medida en suelos areno-arcillosos con un bajo contenido en materia orgánica, un mayor pH y una menor disponibilidad de fósforo y nitrógeno. La supervivencia y el crecimiento de P. oxalicum se correlaciona de forma negativa con la disponibilidad de agua y de forma positiva con el contenido de materia orgánica. Sólo la supervivencia se correlaciona también positivamente con el pH. Por otro lado se realizan ensayos en suelos de huertos comerciales con diferentes propiedades físico-químicas y diferentes condiciones ambientales para ESTUDIAR EL ESTABLECIMIENTO, SUPERVIVENCIA Y DISPERSIÓN VERTICAL Y MOVILIDAD HORIZONTAL DE PO212. P. oxalicum 212 puede persistir y sobrevivir en esos suelos al menos un año después de su liberación pero a niveles similares a los de otras especies de Penicillium indígenas presentes en los mismos suelos naturales. Además, P. oxalicum 212 muestra una dispersión vertical y movilidad horizontal muy limitada en los diferentes tipos de suelo evaluados. La introducción de P. oxalicum en un ambiente natural no sólo implica su actuación sobre el microorganismo diana, el patógeno, si no también sobre otros microorganismos indígenas. Para EVALUAR EL EFECTO DE LA APLICACIÓN DE P. oxalicum SOBRE LAS POBLACIONES FÚNGICAS INDIGENAS PRESENTES EN EL SUELO de dos huertos comerciales, se analizan mediante electroforesis en gradiente desnaturalizante de poliacrilamida (DGGE) muestras de dichos suelos a dos profundidades (5 y 10 cm) y a cuatro fechas desde la aplicación de P. oxalicum 212 (0, 75, 180 y 365 días). El análisis de la DGGE muestra que las diferencias entre las poblaciones fúngicas se deben significativamente a la fecha de muestreo y son independientes del tratamiento aplicado y de la profundidad a la que se tomen las muestras. Luego, la aplicación del ACB no afecta a la población fúngica de los dos suelos analizados. El análisis de las secuencias de la DGGE confirma los resultados anteriores y permiten identificar la presencia del ACB en los suelos. La presencia de P. oxalicum en el suelo se encuentra especialmente relacionada con factores ambientales como la humedad. Por tanto, podemos concluir que Penicillium oxalicum cepa 212 puede considerarse un óptimo Agente de Control Biológico (ACB), puesto que es ecológicamente competitivo, eficaz para combatir un amplio espectro de enfermedades y no supone un riesgo para el resto de microorganismos fúngicos no diana presentes en el lugar de aplicación. ABSTRACT Currently, reduction of active (EU) and the implementation of the new EU Directive 2009/128 which establishing the framework for action to achieve the sustainable use of chemical pesticides and preference of use of biological, physical and other non-chemical methods, forces to look for control methods less harmful to the environment. Biological control (CB) of plant diseases using biological control agents (BCA) is perceived as a safer alternative and with less environmental impact, either alone or as part of an integrated control strategy. The isolate 212 of Penicillium oxalicum (PO212) (ATCC 201888) was originally isolated from the soil mycoflora in Spain. P. oxalicum is a promising biological control agent for Fusarium wilt and other tomato diseases. Once identified and characterized the BCA, was developed a mass production method of conidia by solid-state fermentation. After determined the process of obtaining a formulated product of the BCA by drying of product by fluid-bed drying, it enables the preservation of the inoculum over a long period of time. Finally, some formulations of dried P. oxalicum conidia have been developed which contain one different additive that have improved their viability, stability and facilitated its handling and application. However, further work is needed to improve biocontrol efficacy. The first objective of this thesis has focused on the study of the interaction BCA- pathogen-host, to allow P.oxalicum to work in different pathosystems. The first point to be addressed in this objective is the development of new FORMULATIONS of BCA which increase their effectiveness against vascular wilt of tomato. PO212 conidial formulations were obtained by the joint addition of various additives (wetting agents, adhesives or stabilizers) at two different points of the production-drying process: i) to substrate in the fermentation bags before the production process, and (ii) to conidial paste obtained after production but before drying. Of the 22 new formulations developed and evaluated in tomato plants in greenhouse tests, six of them (FOR22 , FOR25 , FOR32 , FOR35 , FOR36 and FOR3) improved significantly (P = 0.05) the biocontrol efficacy against tomato wilt with respect to that obtained with dried P.oxalicum conidia without additives (CSPO) or the fungicide Bavistin. The formulations that improve the efficiency of dried conidia without additives are those containing as humectants sodium alginate in the fermentation bags, followed by those containing glycerol as a stabilizer in the fermentation bags, and methylcellulose and skimmed milk as adherents before drying. Moreover, control of vascular wilt of tomatoes by PO212 conidial formulations is related to the date of disease onset. Another way to further improve the effectiveness of biocontrol is to improve the active substance by SELECTION OF NEW STRAINS of P. oxalicum, which may have different levels of effectiveness. Of the 28 new strains of P. oxalicum tested in a culture chamber, only PO15 isolate shows the same effectiveness that PO212 (62-67 % of control) against tomato vascular wilt in cases of high disease pressure. Whereas in cases of low disease pressure all strains of P. oxalicum and its mixtures effective. Finally, we study extend the range of action of this BCA TO OTHER GUESTS AND OTHER PATHOGENS AND DIFFERENT DEGREES OF VIRULENCE. In efficacy trials of P. oxalicum against isolates of different aggressiveness of Verticillium spp. and Fusarium oxysporum f. sp. lycopersici in tomato plants in growth chambers, shows that the efficiency of PO212 is negatively correlated with the level of disease caused by F. oxysporum f. sp. lycopersici. There is not differential effect in reducing the incidence or severity depending on the virulence of isolates. However, PO212 cause a greater reduction of disease in plants inoculated with virulent isolates media of V. dahlia. PO212 efficacy was also higher against isolates of high and average virulence of F. oxysporum f. sp. melonis and F. oxysporum f. sp. niveum in melon and watermelon plants, respectively. In both hosts the optimum dose of the BCA application is 107 conidia PO212 g-1 soil, applied on seedlings 7 days before transplantation into the field. Moreover, the reapplication of PO212 (2-4 times) to the roots by irrigation into the field improve efficiency of biocontrol. The efficacy of PO212 is not limited to vascular pathogens as those mentioned above, but also other pathogens such as Oomycetes (Phytophthora cactorum) and nematodes (Globodera pallida and G. rostochiensis). PO212 significantly reduces symptoms (50 %) caused by P. cactorum in strawberry nursery plants after application of BCA by dipping the roots before transplanting to soil in commercial nurseries. Moreover, the exposure of G. pallida and G. rostochiensis cysts to the conidia of P. oxalicum, in in vitro assays or in soil microcosms significantly reduces hatchability of eggs. The reduction in the rate of G. pallida juveniles hatching was greatest when root diffusates from the `Monalisa´ potato cultivar were used, followed by root diffusates from the `Désirée´ potato cultivar. However, no significant reduction in the rate of G. pallida juveniles hatching was found when root diffusates from the ‘San Pedro” tomato cultivar were used. For G. rostochiensis reduction in the juveniles hatching is obtained from the root diffusates 'Desirée' potato cultivar. Treatment with P. oxalicum also significantly reduces the number of cysts of G. pallida in pots. In order to optimize the practical application of P. oxalicum strain 212 as a biological soil treatment, it is essential to understand how the physical environment influences the BCA colonization, survival and growth, and the possible risk that can cause its application on other microorganisms in the ecosystem of performance. Therefore, the second objective of this thesis is the interaction of the BCA with the environment in which it is applied. Within this objective is evaluated the INFLUENCE OF TEMPERATURE, WATER AVAILABILITY AND PHYSICAL-CHEMICAL PROPERTIES OF SOILS (POROSITY, TEXTURE, DENSITY...) ON SURVIVAL AND GROWTH OF PO212 under controlled conditions to develop models for predicting the environmental impact of each factor on survival and growth of P. oxalicum and to know their ability to grow and survive in different environments. Two parameters are evaluated in the soil samples: i) the survival of Penicillium spp. by counting the number of colony forming units in semi-selective medium and ii) growth (biomass) of PO212 by real-time PCR. P. oxalicum grows and survives better in drought conditions regardless of temperature and soil type. P. oxalicum grows and survives more in sandy loam soils with low organic matter content, higher pH and lower availability of phosphorus and nitrogen. Survival and growth of P. oxalicum negatively correlates with the availability of water and positively with the organic content. Only survival also correlated positively with pH. Moreover, trials are carried out into commercial orchards soils with different physic-chemical properties and different environmental conditions TO STUDY THE ESTABLISHMENT, SURVIVAL, VERTICAL DISPERSION AND HORIZONTAL SPREAD OF PO212. P. oxalicum 212 can persist and survive at very low levels in soil one year after its release. The size of the PO212 population after its release into the tested natural soils is similar to that of indigenous Penicillium spp. Furthermore, the vertical dispersion and horizontal spread of PO212 is limited in different soil types. The introduction of P. oxalicum in a natural environment not only involves their action on the target organism, the pathogen, but also on other indigenous microorganisms. TO ASSESS THE EFFECT OF P. oxalicum APPLICATION ON SOIL INDIGENOUS FUNGAL COMMUNITIES in two commercial orchards, soil samples are analyzed by Denaturing Gradient Gel Electrophoresis polyacrylamide (DGGE). Samples are taken from soil at two depths (5 and 10 cm) and four dates from the application of P. oxalicum 212 (0, 75, 180 and 365 days). DGGE analysis shows that differences are observed between sampling dates and are independent of the treatment of P. oxalicum applied and the depth. BCA application does not affect the fungal population of the two soil analyzed. Sequence analysis of the DGGE bands confirms previous findings and to identify the presence of BCA on soils. The presence of P. oxalicum in soil is especially related to environmental factors such as humidity. Therefore, we conclude that the 212 of strain Penicillium oxalicum can be considered an optimum BCA, since it is environmentally competitive and effective against a broad spectrum of diseases and does not have any negative effect on soil non-target fungi communities.

Relevância:

90.00% 90.00%

Publicador:

Resumo:

Debido al futuro incierto de la mayor parte de los fumigantes edáficos usados actualmente en la Unión Europea, que pueden implicar riesgos para la salud humana/animal y el medio ambiente, es necesario desarrollar programas de manejo integrado para el control de plagas de cultivos. Estos programas se incluyen como obligatorios en el Reglamento (EC) No. 1107/2009. De acuerdo con este Reglamento, es obligatoria la evaluación del riesgo asociado al uso de productos fitosanitarios sobre los organismos edáficos no diana y sus funciones, además de llevar a cabo ensayos con diferentes especies indicadoras para obtener datos de toxicidad que puedan ser usados posteriormente en la evaluación de riesgo. Sin embargo, la baja representatividad de algunas de estas especies indicadoras en el área Mediterránea supone una gran limitación. En esta situación, el Panel Científico de Productos Fitosanitarios y sus Residuos de la Autoridad Europea en Seguridad Alimentaria (EFSA), ha señalado la necesidad de modificar los datos ecotoxicológicos requeridos para evaluar los efectos adversos de los productos fitosanitarios de una manera más integrada, incluyendo criterios funcionales y estructurales mediante organismos como bacterias, hongos, protozoos y nematodos. De este modo, la EFSA ha recomendado el uso de los nematodos en la evaluación de la funcionalidad y estructura del suelo. Los nematodos están globalmente distribuidos y son morfológicamente diversos; esto junto con su gran abundancia y diversidad de respuestas a las perturbaciones edáficas, los convierte en indicadores adecuados del estado del suelo. Puesto que los nematodos interaccionan con muchos otros organismos que participan en diferentes eslabones de la red trófica edáfica, jugando papeles importantes en procesos edáficos esenciales en los agroescosistemas, la diversidad de nematodos es, a menudo, usada como indicador biológico de los efectos de las prácticas agrícolas en el estado del suelo. En los últimos años, diferentes índices basados en la comunidad nematológica han facilitado la interpretación de datos complejos sobre la ecología del suelo. Los índices de la red trófica edáfica, basados en la abundancia de grupos funcionales definidos como grupos C-P y grupos tróficos, permiten la evaluación de la funcionalidad de la red trófica edáfica. Por otra parte, la dificultad en la identificación taxonómica de nematodos para explicar su uso limitado como indicadores ecológicos, es ampliamente discutida, y existe cierta controversia en cuanto a la eficacia de los diferentes métodos de identificación de nematodos. Se argumenta que la identificación morfológica es difícil y puede llevar mucho tiempo debido a la falta de expertos especializados, y se afirma que las técnicas moleculares pueden resolver algunas limitaciones de las técnicas morfológicas como la identificación de juveniles. Sin embargo, los métodos de identificación molecular tienen también limitaciones; la mayoría de las bases de datos de secuencias de ADN están fuertemente orientadas hacia los nematodos fitoparásitos, los cuales representan sólo una parte de la comunidad edáfica de nematodos, mientras que hay poca información disponible de nematodos de vida libre a pesar de representar la mayoría de los nematodos edáficos. Este trabajo se centra en el estudio de los efectos de fumigantes edáficos en la funcionalidad del suelo a través del uso de diferentes indicadores basados en la comunidad de nematodos, como los índices de la red trófica, índices de diversidad, abundancia de los taxones más relevantes etc. También se han analizado otros indicadores funcionales relacionados con la supresividad edáfica, el ciclo de nutrientes o la actividad de la microfauna del suelo. En el capítulo 1, la diversidad de nematodos estudiada en una explotación comercial de fresa y sus alrededores durante dos campañas consecutivas en el suroeste español, fue baja en los suelos fumigados con fumigantes químicos ambas campañas y, aunque se observó una recuperación a lo largo de la campaña en la zona tratada, los suelos fumigados mostraron una condición perturbada permanente. La comunidad de nematodos estuvo más asociada al ciclo de nutrientes en la zona sin cultivar que en los suelos cultivados, y se observó poca relación entre la biomasa de las plantas y la estructura de la comunidad de nematodos. Los surcos sin tratar dentro de la zona de cultivo funcionaron como reservorio tanto de nematodos fitoparásitos como beneficiosos; sin embargo estas diferencias entre los surcos y los lomos de cultivo no fueron suficientes para mantener la supresividad edáfica en los surcos. Los suelos tratados fueron menos supresivos que los suelos sin tratar, y se observaron correlaciones positivas entre la supresividad edáfica y la estructura de la red trófica edáfica y la diversidad de nematodos. En el capítulo 2, se evaluaron los efectos de dos pesticidas orgánicos con efecto nematicida y dos nematicidas convencionales sobre las propiedades físico químicas del suelo, la diversidad de nematodos y la biomasa de las plantas en condiciones experimentales en dos tipos de suelo: suelos agrícolas poco diversos y suelos provenientes de una zona de vegetación natural muy diversos. El mayor efecto se observó en el tratamiento con neem, el cual indujo un gran incremento en el número de dauerlarvas en los suelos pobres en nutrientes, mientras que el mismo tratamiento indujo un incremento de poblaciones de nematodos bacterívoros, más estables y menos oportunistas, en los suelos del pinar ricos en materia orgánica. En el capítulo 3, se comparó la eficacia de métodos moleculares (TRFLP, Terminal Restriction Fragment Length Polymorphism) y morfológicos (microscopía de alta resolución) para la identificación de diferentes comunidades denematodos de España e Irlanda. Se compararon estadísticamente las diferencias y similitudes en la diversidad de nematodos, otros indicadores ecológicos y de la red trófica edáfica. Las identificaciones mediante el uso de TRFLP sólo detectó un porcentaje de los taxones presentes en las muestras de suelo identificadas morfológicamente, y los nematodos omnívoros y predadores no fueron detectados molecularmente en nuestro estudio. Los índices calculados en base a los nematodos micróboros mostraron más similitud cuando se identificaron morfológica y molecularmente que los índices basados en grupos tróficos más altos. Nuestros resultados muestran que, al menos con la técnica usada en este estudio, la identificación morfológica de nematodos es una herramienta fiable y más precisa que la identificación molecular, puesto que en general se obtiene una mayor resolución en la identificación de nematodos. En el capítulo 4, se estudiaron también los efectos de los nematicidas químicos sobre la comunidad de nematodos y la biomasa de las plantas en condiciones experimentales de campo, donde se aplicaron en una rotación de cultivo judía-col durante un ciclo de cultivo. Se aplicaron dos tipos de enmiendas orgánicas con el objetivo de mitigar el efecto negativo de los productos fitosanitarios sobre la diversidad edáfica. El efecto de los nematicidas sobre las propiedades del suelo y sobre la comunidad de nematodos fue más agudo que el efecto de las enmiendas. La incorporación de los restos de cosecha al final del ciclo de cultivo de la judía tuvo un gran efecto sobre la comunidad de nematodos, y aunque el número total de nematodos incrementó al final del experimento, se observó una condición perturbada permanente de la red trófica edáfica a lo largo del experimento. ABSTRACT Due to the uncertain future of the soil fumigants most commonly used in the EU, that might involve risks for human/animal health and the environment, there is a need to develop new integrated pest management programs, included as mandatory in the Regulation (EC) No. 1107/2009, to control crop diseases. According to this Regulation, evaluating the risk associated to the use of the plant production products (PPP) on non-target soil fauna and their function, and developing assays with different indicator species to obtain toxicity data to be used in the risk evaluation is mandatory. However, the low representativeness of some of these indicator species in the Mediterranean area is a relevant limitation. In this situation, the Scientific Panel of Plant Protection Products and their Residues of the European Food Safety Authority (EFSA) has pointed out the necessity of modifying the ecotoxicological data set required to evaluate non-target effects of PPP in a more integrated way, including structural and functional endpoints with organism such as bacteria, fungi, protists and nematodes. Thus, EFSA has recommended the use of nematodes in the assessment of the functional and structural features of the soil. Nematodes are globally distributed and morphologically diverse, and due to their high abundance and diversity of responses to soil disturbance, they are suitable indicators of the soil condition. Since nematodes interact with many other organisms as participants in several links of the soil food web, playing important roles in essential soil processes in agroecosystems, nematode diversity is often used as a biological indicator of the effects of agricultural practices on soil condition. In the last years, various indices based on soil nematode assemblages, have facilitated the interpretation of complex soil ecological data. Soil food web indices based on the abundances of functional guilds defined by C-P groups and trophic groups, permit evaluating soil food web functioning. On the other hand, the difficulty of nematode taxonomical identification is commonly argued to explain their limited used as ecological indicators, and there is a certain controversy in terms of the efficacy of various nematode identification methods. It is argued that the morphological identification is difficult and time consuming due to the lack of specialist knowledge, and it is claimed that molecular techniques can solve some limitations of morphological techniques such as the identification of juveniles. Nevertheless, molecular identification methods are limited too, since most of the DNA-based databases are strongly oriented towards plant-parasitic nematodes that represent only a fraction of the soil nematode community, while there is little information available on free-living nematodes, which represent most soil nematodes. This work focuses on the study of the effects of soil fumigants on soil functioning through the use of different indicators based on soil nematode community as soil food web indices, diversity indices, the abundance of more relevant taxa etc. Other functional indicators related to soil suppressiveness, nutrient cycling, or the activity of soil microfauna have been also studied. In chapter 1, nematode diversity assessed in a commercial strawberry farm and its surroundings for two consecutive growing seasons in southern Spain, was low in fumigated soils with chemical pesticides throughout both seasons and, although yearly recovery occurred within the treated fields, fumigated soils showed a permanent perturbed condition. The nematode community was more closely associated to nutrient cycling in the non-cropped than in the cropped soils, and the link between plant biomass and nematode community structure was weak. Non-treated furrows within the treated fields were a reservoir of both beneficial and plant-parasitic nematodes, but such difference between furrows and beds was not enough to maintain more suppressive soil assemblages in the furrows. Treated soils were less suppressive than unmanaged soils, and there was a positive and significant correlation between soil suppressiveness and soil food web structure and diversity. In chapter 2, the effects of two organic pesticides with nematicide effect and two chemical nematicides on soil physicalchemical properties, soil nematode diversity and plant biomass in experimental conditions were assessed in two types of soils: low diversity soils from an agricultural farm, and high diversity soils from a natural vegetation area. The larger effect was observed on the neem treatment, which induced a large boost of dauer juveniles in the nutrient-depleted soil, while the same treatment induced the increase of more stable, less opportunistic, populations of generalist bacterivore nematodes in the pine forest soil, rich in organic matter. In chapter 3, comparison of the efficiency of molecular (TRFLP, Terminal Restriction Fragment Length Polymorphism) and morphological (microscopy at high magnification) identification methods was carried out in different nematode communities from five sites of different land uses in Spain and Ireland. Differences and similarities on nematode diversity and other ecological and soil food web indices assessed by both methods, were statistically compared. Molecular identification with TRFLP only detected a percentage of the taxa present in the soil samples identified morphologically, and omnivores and predators were not detected molecularly in our study. Indices involving microbial feeding nematodes were more similar between identification methods than indices involving higher trophic links. Our results show that, at least with the technique used in this study, identifying nematodes morphologically is a reliable and more precise identification tool than molecular identification, since a higher taxonomic resolution is in general obtained compared to TRFLP. In chapter 4, the effect of chemical nematicides on nematode community descriptors and plant biomass was also studied in field conditions in an experimental area in which dazomet and dimethyl disulfide was applied in a bean-cabbage rotation system for a single season. Organic amendments were incorporated into the soil with the aim of mitigate the negative effect of the pesticides on soil diversity. The effect of the nematicides was much more noticeable than the effect of the amendments on soil properties and nematode community descriptors. The incorporation of bean crop residues into the soil at the end of bean crop cycle affected soil nematode community descriptors to a great extent, and although total number of nematodes increased at the end of the experiment, a permanent perturbed soil food web condition was observed along the experiment.

Relevância:

90.00% 90.00%

Publicador:

Resumo:

Metamorphosis is both an ecological and a developmental genetic transition that an organism undergoes as a normal part of ontogeny. Many organisms have the ability to delay metamorphosis when conditions are unsuitable. This strategy carries obvious benefits, but may also result in severe consequences for older larvae that run low on energy. In the marine environment, some lecithotrophic larvae that have prolonged periods in the plankton may begin forming postlarval and juvenile structures that normally do not appear until after settlement and the initiation of metamorphosis. This precocious activation of the postlarval developmental program may reflect an adaptation to increase the survival of older, energy-depleted larvae by allowing them to metamorphose more quickly. In the present study, we investigate morphological and genetic consequences of delay of metamorphosis in larvae of Herdmania momus (a solitary stolidobranch ascidian). We observe significant morphological and genetic changes during prolonged larval life, with older larvae displaying significant changes in RNA levels, precocious migration of mesenchyme cells, and changes in larval shape including shortening of the tail. While these observations suggest that the older H. momus larvae are functionally different from younger larvae and possibly becoming more predisposed to undergo metamorphosis, we did not find any significant differences in gene expression levels between postlarvae arising from larvae that metamorphosed as soon as they were competent and postlarvae developing from larvae that postponed metamorphosis. This recalibration, or convergence, of transcript levels in the early postlarva suggests that changes that occur during prolonged larval life of H. momus are not necessarily associated with early activation of adult organ differentiation. Instead, it suggests that an autonomous developmental program is activated in H. momus upon the induction of metamorphosis regardless of the history of the larva.

Relevância:

90.00% 90.00%

Publicador:

Resumo:

Estrogens can be labeled with the positron-emitting radionuclide fluorine-18 (t$\sb{1/2}$ = 110 min) by fluoride ion (n-Bu$\sb4$N$\sp{18}$F) displacement of a 16$\beta$-trifluoromethanesulfonate (triflate) derivative of the corresponding estrone 3-triflate, and purification by HPLC. That sequence has been used to synthesize the 11$\beta$-methoxy 1 and 11$\beta$-ethyl 2 analogues of the breast tumor imaging agent, 16$\alpha$-($\sp{18}$F) fluoro-17$\beta$-estradiol (FES). Tissue distribution studies of 1 and 2 in immature female rats show high selectivity for target tissue (T, uterus) vs non-target (NT, muscle and lung), with T/NT ratios being 43 and 17 at one hour after injection for 1 and 2, respectively. The parent estrogen FES has previously been shown to display an intermediate value for tissue selectivity.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

Ofloxacin is an antimicrobial agent frequently found in significant concentrations in wastewater and surface water. Its continuous introduction into the environment is a potential risk to non-target organisms or to human health. In this study, ofloxacin degradation by UV/TiO2 and UV/TiO2/H2O2, antimicrobial activity (E. coli) of samples subjected to these processes, and by-products formed were evaluated. For UV/TiO2, the degradation efficiency was 89.3% in 60 min of reaction when 128 mg L(-1) TiO2 were used. The addition of 1.68 mmol L(-1) hydrogen peroxide increased degradation to 97.8%. For UV/TiO2, increasing the catalyst concentration from 4 to 128 mg L(-1) led to an increase in degradation efficiency. For both processes, the antimicrobial activity was considerably reduced throughout the reaction time. The structures of two by-products are presented: m/z 291 (9-fluoro-3-methyl-10-(methyleneamino)-7-oxo-2,3-dihydro-7H-[1,4]oxazino[2,3,4-ij]quinoline-6-carboxylic acid) and m/z 157 ((Z)-2-formyl-3-((2-oxoethyl)imino)propanoic acid).

Relevância:

80.00% 80.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

Objective: The aim of this study was to investigate the effects of photodynamic therapy (PDT) on endodontic pathogens by evaluating the decrease in numbers of Enterococcus faecalis colonies in the canals of extracted human teeth. Background Data: Failure in endodontics is usually related to inadequate cleaning and disinfection of the root canal system. This is due to the establishment of microorganisms in areas where the instruments and chemical agents used during root canal preparation cannot eliminate them. PDT is a complementary therapeutic method that could be used to eliminate these remaining bacteria. PDT is a process in which radiation acts on a dye that is applied to the target organism, resulting in bacterial death. Materials and Methods: Forty-six uniradicular teeth had their canals contaminated with bacteria and were incubated for 48 h at 35 degrees C. After that, the teeth were divided into a control group (CG) and a test group (TG). The 23 CG teeth did not undergo any intervention, whereas in the TG the teeth received a solution of 0.0125% toluidine blue for 5 min followed by irradiation using a 50-mW diode laser (Ga-Al-As) at a wavelength of 660 nm. Bacterial samples were taken before and after irradiation. In each of the samples, the number of colony-forming units (CFU) was counted. Results: The mean decrease in CFU was 99.9% in the TG, whereas in the CG an increase of 2.6% was observed. Conclusion: PDT was effective as a bactericidal agent in Enterococcus faecalis-contaminated root canals.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

Fungal entomopathogens have been used more frequently than other types of pathogens for classical biological control. Among 136 programs using different groups of arthropod pathogens, 49.3% have introduced fungal pathogens (including both the traditional fungi and microsporidia). The most commonly introduced species was Metarhizium anisopliae (Metschnikoff) Sorokin, with 13 introductions, followed by Entomophaga maimaiga Humber, Shimazu & Soper, which was released seven times. The majority of introduction programs have focused on controlling invasive species of insects or mites (70.7%) rather than on native hosts (29.4%). Almost half of the introductions of traditional fungi targeted species of Hemiptera and 75% of the microsporidia introduced have been introduced against lepidopteran species. The United States was the country where most introductions of fungi took place (n = 24). From 1993 to 2007, no arthropod pathogens were released in the US due to the rigorous regulatory structure, but in 2008 two species of microsporidia were introduced against the gypsy moth, Lymantria dispar (L.). Establishment of entomopathogenic fungi in programs introducing traditional fungi was 32.1% and establishment was 50.0% for programs introducing microsporidia. In some programs, releases have resulted in permanent successful establishment with no non-target effects. In summary, classical biological control using fungal entomopathogens can provide a successful and environmentally friendly avenue for controlling arthropod pests, including the increasing numbers of invasive non-native species.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

Proteinase inhibitors (PI) are present in plant tissues, especially in seeds, and act as a defense mechanism against herbivores and pathogens. Serine PI from soybean such as Bowman-Birk (BBPI) and Kunitz have been used to enhance resistance of sugarcane varieties to the sugarcane borer Diatraea saccharalis (Fabricius) (Lepidoptera: Crambidae), the major pest of this crop. The use of these genetically-modified plants (GM) expressing PI requires knowledge of its sustainability and environmental safety, determining the stability of the introduced characteristic and its effects on non-target organisms. The objective of this study was to evaluate direct effects of ingestion of semi-purified and purified soybean PI and GM sugarcane plants on the soil-dwelling mite Scheloribates praeincisus (Berlese) (Acari: Oribatida). This mite is abundant in agricultural soils and participates in the process of organic matter decomposition; for this reason it will be exposed to PI by feeding on GM plant debris. Eggs of S. praeincisus were isolated and after larvae emerged, immatures were fed milled sugarcane leaves added to semi-purified or purified PI (Kunitz and BBPI) or immatures were fed GM sugarcane varieties expressing Kunitz and BBPI type PI or the untransformed near isogenic parental line variety as a control. Developmental time (larva-adult) and survival of S. praeincisus was evaluated. Neither Kunitz nor BBPI affected S. praeincisus survival. On the other hand, ingestion of semi-purified and purified Kunitz inhibitor diminished duration of S. praeincisus immature stages. Ingestion of GM senescent leaves did not have an effect on S. praeincisus immature developmental time and survival, compared to ingestion of leaves from the isogenic parental plants. These results indicate that cultivation of these transgenic sugarcane plants is safe for the non-target species S. praeincisus.