Structure of molten TbCl3 measured by neutron diffraction

The total structure factor of molten TbCl3 at 617ºC was measured by using neutron diffraction. The data are in agreement with results from previous experimental work but the use of a diffractometer having an extended reciprocal-space measurement window leads to improved resolution in real space. Significant discrepancies with the results obtained from recent molecular dynamics simulations carried out using a polarizable ion model, in which the interaction potentials were optimized to enhance agreement with previous diffraction data, are thereby highlighted. It is hence shown that there is considerable scope for the development of this model for TbCl3 and for other trivalent metal halide systems spanning a wide range of ion size ratios.

Probing crystallisation of a fluoro-apatite - mullite system using neutron diffraction

Real-time small angle neutron scattering and wide angle neutron scattering studies were undertaken concurrently on a glass ionomer of nominal composition 4.5(SiO2)-3(Al2O3)-1.5(P2O5)-3(CaO)-2(CaF2). Neutron studies were conducted as a function of temperature to investigate the crystallisation process. No amorphous phase separation was observed at room temperature and the onset of crystallisation was found to occur at 650°C, which is 90°C lower than previously reported. The first crystalline phase observed corresponded to fluorapatite; it was only upon further heating was the mullite phase became present. The crystallite size at 650°C was found to be ~115Å and the result was consistent across all measurements.

Determination of toluene hydrogenation kinetics with neutron diffraction

Total neutron scattering has been used to follow the hydrogenation of toluene-d₈ to methylcyclohexane-d₁₄ over 3 wt% platinum supported on highly ordered mesoporous silica (MCM-41) at 298 K and under 150 mbar D₂ pressure. The detailed kinetic information so revealed indicates that liquid reorganisation inside pores is the slowest step of the whole process. Additionally, the results were compared with the reaction performed under 250 mbar D₂ pressure as well as with toluene-h₈ hydrogenation using D₂ at 150 mbar.

Accurate molecular structures of chlorothiazide and hydrochlorothiazide by joint refinement against powder neutron and X-ray diffraction data

The compounds chlorothiazide and hydrochlorothiazide (crystalline form II) have been studied in their fully hydrogenous forms by powder neutron diffraction on the GEM diffractometer. The results of joint Rietveld refinement of the structures against multi-bank neutron and single-bank X-ray powder data are reported and show that accurate and precise structural information can be obtained from polycrystalline molecular organic materials by this route.

Combined neutron and X-ray diffraction studies of DNA in crystals and solutions

Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.

Magnetic ordering of EuTe/PbTe multilayers determined by x-ray resonant diffraction

In this work we use resonant x-ray diffraction combined with polarization analysis of the diffracted beam to study the magnetic ordering in EuTe/PbTe multilayers. The presence of satellites at the (1/2 1/2 1/2) magnetic reflection of a 50 /repetition EuTe/PbTe superlattice demonstrated the existence of magnetic correlations among the alternated EuTe layers. The behavior of the satellites intensity as T increases toward the Neel temperature T(N) indicates that these correlations persist nearly up to T(N) and suggests the preferential decrease of the magnetic order parameter of external monolayers of each EuTe layer within the superlattice. (C) 2008 American Institute of Physics.

Neutron structure of type-III antifreeze protein allows the reconstruction of AFP-ice interface.

Antifreeze proteins (AFPs) inhibit ice growth at sub-zero temperatures. The prototypical type-III AFPs have been extensively studied, notably by X-ray crystallography, solid-state and solution NMR, and mutagenesis, leading to the identification of a compound ice-binding surface (IBS) composed of two adjacent ice-binding sections, each which binds to particular lattice planes of ice crystals, poisoning their growth. This surface, including many hydrophobic and some hydrophilic residues, has been extensively used to model the interaction of AFP with ice. Experimentally observed water molecules facing the IBS have been used in an attempt to validate these models. However, these trials have been hindered by the limited capability of X-ray crystallography to reliably identify all water molecules of the hydration layer. Due to the strong diffraction signal from both the oxygen and deuterium atoms, neutron diffraction provides a more effective way to determine the water molecule positions (as D(2) O). Here we report the successful structure determination at 293 K of fully perdeuterated type-III AFP by joint X-ray and neutron diffraction providing a very detailed description of the protein and its solvent structure. X-ray data were collected to a resolution of 1.05 Å, and neutron Laue data to a resolution of 1.85 Å with a "radically small" crystal volume of 0.13 mm(3). The identification of a tetrahedral water cluster in nuclear scattering density maps has allowed the reconstruction of the IBS-bound ice crystal primary prismatic face. Analysis of the interactions between the IBS and the bound ice crystal primary prismatic face indicates the role of the hydrophobic residues, which are found to bind inside the holes of the ice surface, thus explaining the specificity of AFPs for ice versus water.

Glassy magnetic phase driven by short range charge and magnetic ordering in nanocrystalline La1/3Sr2/3FeO3-δ: Magnetization, Mössbauer, and polarized neutron studies

The charge ordered La1/3Sr2/3FeO3−δ (LSFO) in bulk and nanocrystalline forms are investigated using ac and dc magnetization, M¨ossbauer, and polarized neutron studies. A complex scenario of short-range charge and magnetic ordering is realized from the polarized neutron studies in nanocrystalline specimen. This short-range ordering does not involve any change in spin state and modification in the charge disproportion between Fe3+ and Fe5+ compared to bulk counterpart as evident in the M¨ossbauer results. The refinement of magnetic diffraction peaks provides magnetic moments of Fe3+ and Fe5+ are about 3.15 μB and 1.57 μB for bulk, and 2.7 μB and 0.53 μB for nanocrystalline specimen, respectively. The destabilization of charge ordering leads to magnetic phase separation, giving rise to the robust exchange bias (EB) effect. Strikingly, EB field at 5 K attains a value as high as 4.4 kOe for average size ∼70 nm, which is zero for the bulk counterpart. A strong frequency dependence of ac susceptibility reveals cluster-glass-like transition around ∼65 K, below which EB appears. Overall results propose that finite-size effect directs the complex glassy magnetic behavior driven by unconventional short-range charge and magnetic ordering, and magnetic phase separation appears in nanocrystalline LSFO.

Structure determination from powder diffraction data

Advances made over the past decade in structure determination from powder diffraction data are reviewed with particular emphasis on algorithmic developments and the successes and limitations of the technique. While global optimization methods have been successful in the solution of molecular crystal structures, new methods are required to make the solution of inorganic crystal structures more routine. The use of complementary techniques such as NMR to assist structure solution is discussed and the potential for the combined use of X-ray and neutron diffraction data for structure verification is explored. Structures that have proved difficult to solve from powder diffraction data are reviewed and the limitations of structure determination from powder diffraction data are discussed. Furthermore, the prospects of solving small protein crystal structures over the next decade are assessed.

Structure determination from powder diffraction data

Advances made over the past decade in structure determination from powder diffraction data are reviewed with particular emphasis on algorithmic developments and the successes and limitations of the technique. While global optimization methods have been successful in the solution of molecular crystal structures, new methods are required to make the solution of inorganic crystal structures more routine. The use of complementary techniques such as NMR to assist structure solution is discussed and the potential for the combined use of X-ray and neutron diffraction data for structure verification is explored. Structures that have proved difficult to solve from powder diffraction data are reviewed and the limitations of structure determination from powder diffraction data are discussed. Furthermore, the prospects of solving small protein crystal structures over the next decade are assessed.

Three dimensional picture of the local structure of 1,4-Polybutadiene from a complete atomistic model and neutron scattering data

An efficient method of combining neutron diffraction data over an extended Q range with detailed atomistic models is presented. A quantitative and qualitative mapping of the organization of the chain conformation in both glass and liquid phase has been performed. The proposed structural refinement method is based on the exploitation of the intrachain features of the diffraction pattern by the use of internal coordinates for bond lengths, valence angles and torsion rotations. Models are built stochastically by assignment of these internal coordinates from probability distributions with limited variable parameters. Variation of these parameters is used in the construction of models that minimize the differences between the observed and calculated structure factors. A series of neutron scattering data of 1,4-polybutadiene at the region 20320 K is presented. Analysis of the experimental data yield bond lengths for C-C and C=C of 1.54 and 1.35 Å respectively. Valence angles of the backbone were found to be at 112 and 122.8 for the CCC and CC=C respectively. Three torsion angles corresponding to the double bond and the adjacent R and β bonds were found to occupy cis and trans, s(, trans and g( and trans states, respectively. We compare our results with theoretical predictions, computer simulations, RIS models, and previously reported experimental results.

A complete atomistic model of molten polyethylene from neutron scattering data: a new methodology for polymer structure

A new approach to the study of the local organization in amorphous polymer materials is presented. The method couples neutron diffraction experiments that explore the structure on the spatial scale 1–20 Å with the reverse Monte Carlo fitting procedure to predict structures that accurately represent the experimental scattering results over the whole momentum transfer range explored. Molecular mechanics and molecular dynamics techniques are also used to produce atomistic models independently from any experimental input, thereby providing a test of the viability of the reverse Monte Carlo method in generating realistic models for amorphous polymeric systems. An analysis of the obtained models in terms of single chain properties and of orientational correlations between chain segments is presented. We show the viability of the method with data from molten polyethylene. The analysis derives a model with average C-C and C-H bond lengths of 1.55 Å and 1.1 Å respectively, average backbone valence angle of 112, a torsional angle distribution characterized by a fraction of trans conformers of 0.67 and, finally, a weak interchain orientational correlation at around 4 Å.

A detailed single chain model for molten poly(tetrafluoroethylene) from a novel structure refinement technique on neutron scattering data

We present a new methodology that couples neutron diffraction experiments over a wide Q range with single chain modelling in order to explore, in a quantitative manner, the intrachain organization of non-crystalline polymers. The technique is based on the assignment of parameters describing the chemical, geometric and conformational characteristics of the polymeric chain, and on the variation of these parameters to minimize the difference between the predicted and experimental diffraction patterns. The method is successfully applied to the study of molten poly(tetrafluoroethylene) at two different temperatures, and provides unambiguous information on the configuration of the chain and its degree of flexibility. From analysis of the experimental data a model is derived with CC and CF bond lengths of 1.58 and 1.36 Å, respectively, a backbone valence angle of 110° and a torsional angle distribution which is characterized by four isometric states, namely a split trans state at ± 18°, giving rise to a helical chain conformation, and two gauche states at ± 112°. The probability of trans conformers is 0.86 at T = 350°C, which decreases slightly to 0.84 at T = 400°C. Correspondingly, the chain segments are characterized by long all-trans sequences with random changes in sign, rather anisotropic in nature, which give rise to a rather stiff chain. We compare the results of this quantitative analysis of the experimental scattering data with the theoretical predictions of both force fields and molecular orbital conformation energy calculations.