Avaliação da bioquímica sanguínea de pacientes com paracoccidioidomicose, tratados com cotrimoxazol ou itraconazol

Pós-graduação em Doenças Tropicais - FMB

PCR fluorescente associada à eletroforese capilar como ferramenta de diagnóstico de bactérias no semen

This study was performed in order to evaluate the detection limit of PCR with fluorescent capillary electrophoresis for Brucella abortus diagnosis in bovine semen. Negative bovine semen samples were artificially contaminated with B. abortus (10(0) to 10(7) bacteria/mL) and DNA was extracted by phenol/chloroform protocol. DNA was amplified by PCR with oligonucleotides previously described BF-5'gcgctcaggctgccgacgcaa3' (6-FAM labeled) and BR-5'accagccattgcggtcggta3' for B. abortus. Oligonucleotides generated DNA fragments of 193 bp. DNA fragments visualization was done under UV light at silver stained 8% poliacrylamide gel, and fluorescent capillary electrophoresis performed in an automatic DNA fragment analyzer. The detection limit of capillary electrophoresis for B. abortus was 10³ bacteria/mL, while for silver stained 8% poliacrylamide gel it was 10(5) bacteria/mL. PCR with fluorescent capillary electrophoresis is fast, efficient and highly sensitive test for DNA detection of Brucella in bovine semen, and itcan be an important tool for health evaluation of the herd and semen sanitary control in artificial insemination centers.

Avaliação da disseminação de Salmonella Senftenberg isoladas de diversos ambientes avícolas utilizando a técnica de Pulsed Field Gel Electrophoresis

Pós-graduação em Microbiologia - IBILCE

Avaliação da absorção colostral em neonatos ovinos da raça Bergamácia

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Eletroforese das proteínas séricas e urinárias de cães com erliquiose na fase aguda

Pós-graduação em Medicina Veterinária - FCAV

Avaliação da atividade antioxidante, fotoprotetora e antiglicante dos extratos das folhas e flores de Moringa oleifera

Pós-graduação em Biociências - FCLAS

Avaliação dos constituintes proteicos do plasma seminal e da membrana plasmática se espermatozóides e sua correlação com a fertilidade de garanhões

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Avaliação do potencial antioxidante e antiglicante de fitoterápicos utilizados para os sintomas de climatério

Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)

Acidose ruminal subaguda em ovinos Santa Inês: estudo clínico, laboratorial e avaliação da laminite por termografia infravermelha e radiologia digital

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Análise de flavanóides por cromatografia líquida de alta eficiência e eletroforese capilar - otimização de separação e aplicações tecnológicas

No presente trabalho foram estudadas as separações de 18 flavonóides (9 agliconas e 9 glicosídeos) pelas técnicas de Cromatografia Líquida de Alta Eficiência em fase reversa (RP-HPLC) e Cromatografia Micelar Eletrocinética em fluxo reverso (RF-Meck). Em ambas as técnicas foram avaliados solventes puros (metanol, acetonitrila e tetrahidrofurano) e suas misturas como formas de promover a variação de seletividade, através da modificação da fase móvel em HPLC, e da natureza do aditivo orgânico em RF-Meck. Nos estudos efetuados em HPLC utilizando-se gradiente, pode-se comprovar a possibilidade da modelagem do fator de retenção em funçã da proporção de solvente utilizados (MeOH, ACN, THF e suas misturas). Pode-se ainda, com base nos dados de retenção e na análise hierárquica de c1usters, diferenciar quatro diferentes grupos de sistemas cromatográficos com diferentes seletividades para flavonóides agliconas, e outros quatro com diferentes seletividades para glicosídeos. Os sistemas cromatográficos mais ortogonais (cada um pertencente a um grupo de seletividade) foram aplicados na separação de uma planta modelo (Azadirachta indica), de onde pode-se escolher a fase móvel mais seletiva para se otimizar a separação dos flavonóides glicosilados presentes nas folhas desta planta. No método final otimizado pode-se identificar e quantificar cinco dos flavonóides majoritários presentes, sendo três glicosídeos de quercetina (rutina, isoquercitrina e quercitrina) e dois glicosídeos de kaempferol (astragalin e nicotiflorin), em amostras de duas diferentes procedências (Piracicaba-SP e Silvânia-GO). Nos estudos envolvendo a separação dos dezoito flavonóides por RFMEKC pode-se comprovar diferenças significativas de seletividade quando se varia a natureza do solvente orgânico utilizado como aditivo, além de se observar tendências na migração em função das propriedades do solvente adicionado e da estrutura molecular do flavonóide. O solvente de menor eficiência para separação dos flavonóides foi o MeOH. Através da análise dos eletroferogramas obtidos através de um planejamento experimental de misturas, e das trocas de pares críticos observadas nos vários eletrólitos utilizados, obteve-se um método de separação com apenas um par crítico em menos de 12 minutos de corrida. O coeficiente de variação obtido para o fator de retenção foi de 1,5% e para área de 3%, considerando-se cinco injeções. O método desenvolvido foi aplicado com sucesso na identificação dos flavonóides majoritários presentes na planta modelo (Neem), obtendo-se o mesmo resultado do estudo anterior. Como forma de avaliar a concentração de flavonóides totais presentes em espécies vegetais é comum a análise de extratos após hidrólise ácida (conversão de todos glicosídeos em agliconas). Desta forma otimizou-se uma metodologia de separação em RP-HPLC de 8 flavonóides agliconas comumente presentes em alimentos e extratos vegetais de uso cosmético. A otimização foi efetuada mediante um planejamento experimental de misturas, para escolha da fase móvel mais seletiva, e de um planejamento fatorial composto central, para otimização das condições de gradiente. O método obtido foi o mais rápido já visto dentro da literatura consultada. A separação em linha de base foi efetuada em menos de 15 minutos, com coeficientes de variação de área entre 0,1 e 1,8%, coeficiente de correlação de 0,9993 a 0,9994 na faixa de 5 a 100 µg/mL, e limites de quantificação estimados na faixa de 0,1 a 0,21µg/mL. O método desenvolvido foi aplicado na otimização das condições de hidrólise de um extrato de Neem. A otimização foi efetuada através de metodologia de superfície de resposta, levando-se em consideração a concentração de ácido adicionada, o tempo de reação, a temperatura, e a concentração de um antioxidante (ácido ascórbico) adicionado. O resultado da otimização foi uma metodologia de hidrólise com tempo de reação igual a 5 minutos, utilizando-se 1,4 mol/L de HCI, 119°C e 500 µg/mL de ácido ascórbico. Através das metodologias de análise e de hidrólise desenvolvidas pode-se constatar a presença e quantificar no extrato de Neem os flavonóides agliconas quercetina, kaempferol e miricetina. Com o objetivo de se avaliar quais os componentes presentes em extratos vegetais são os responsáveis pelo poder antioxidante atribuído a determinadas plantas, foi montado um sistema de avaliação de poder antioxidante \"on-line\" com reação pós-coluna em HPLC (baseado na literatura) utilizando-se como \"radical livre modelo\" o ABTS. A análise da planta modelo (Neem) neste sistema mostrou que os flavonóides glicosilados identificados nas partes anteriores deste trabalho são os responsáveis pelo poder antioxidante atribuído a esta planta. De posse desta informação, e visando a obtenção de extratos para aplicações cosméticas com poder antioxidante, modelou-se a extração dos flavonóide do Neem em função da composição do solvente extrator (água, etanol , propilenoglicol e suas misturas), de acordo com um planejamento simplex centróide ampliado. Além da previsão da concentração dos princípios ativos pode-se ainda prever outras propriedades dos extratos obtidos, tais como, índice de refração e densidade, muitas vezes constituintes de especificações técnicas de acordo com as aplicações a que se destinam (cremes, xampús, etc).

Análise estrutural e avaliação do efeito condroitim sulfato extraído de tilápia (Oreochromis niloticus) em modelo de peritonite aguda

Chondroitin sulfate (CS) is a naturally glycosaminoglycan found in the extracellular matrix of connective tissues and it may be extracted and purified those tissues. CS is involved in various biological functions, which may be related to the having structural variability, despite the simplicity of the linear chain structure from this molecule. Researches in biotechnology and pharmaceutical field with wastes from aquaculture has been developed in Brazil. In recent decades, tilapia (Oreochromis niloticus), native fish from Africa, has been one of the most cultivated species in various regions of the world, including Brazil. The tilapia farming is a cost-effective activity, however, it generates large amount of wastes that are discarded by producers. It is understood that waste from tilapia can be used in research as a source of molecules with important biotechnological applications, which also helps in reducing environmental impacts and promote the development of an ecofriendly activity. Thus, nile tilapia viscera were subjected to proteolysis, then the glycosaminoglycans were complexed with ion exchange resin (Lewatit), it was fractionated with increasing volumes of acetone and purified by ion exchange chromatography DEAE-Sephacel. Further, the fraction was analyzed by agarose gel electrophoresis and nuclear magnetic resonance (NMR). The electrophoretic profile of the compound together the analysis of 1H NMR spectra and the HSQC correlation allow to affirm that the compound corresponds to a molecule like chondroitin sulfate. MTT assay was used to assess cell viability in the presence of CS tilapia isolated and showed that the compound is not cytotoxic to normal cells such as cells from the mouse embryo fibroblast (3T3). Then, this compound was tested for the ability to reduce the influx of leukocytes in model of acute peritonitis (in vivo) induced by sodium thioglycolate. In this context, it was done total and differential leukocytes counting in the blood and peritoneal fluid collected respectively from vena cava and the peritoneal cavity of the animals subjected to the experiment. The chondroitin sulfate for the first time isolated from tilapia (CST ) was able to reduce the migration of leukocytes to the peritoneal cavity of inflamed mice until 80.4 per cent at a dose 10µg/kg. The results also show that there was a significant reduction (p<0.001) of the population of polymorphonuclear leukocytes from peritoneal cavity in the three tested doses (0.1µg/kg; 1µg/kg and 10µg/kg) when it was compared to the positive control (just thioglycolate). Therefore, since the CST structure and mechanism of action has been completely elucidated, this compound may have potential for therapeutic use in inflammatory diseases

Avaliação do potencial anti-inflamatório, anticoagulante e hemorrágico de heparinóides presentes em "Artemia franciscana"

Heparan sulfate (HS) and Heparin (Hep) glycosaminoglycans (GAGs) are heterogeneous and highly charged polysaccharides. HS is structurally related to Hep but is much less substituted with sulfo groups than heparin and has a more varied structure (or sequence). Because of structural similiarities between these two polymers, they have been described together as heparinoids . Both chains bind a variety of proteins and mediate various physiologically important processes including, blood coagulation, cell adhesion and growth factor regulation. Heparinoids with structural characteristics similar to these described from HS and/or Hep from mammalian tissues have been isolated from different species of invertebrates, although only a few heparinoids from unusual sources have been characterized. The present study describes the presence of unusual heparinoids population from Artemia franciscana, isolated after proteolysis and fractionation by ion exchange resin and named, F-3.0M. The study model in vivo were hemostasis (rat tail scarification) and inflamatoty activity. The tests in vitro were used for coagulations assays (PT and APTT). The analyse of the heparinoids eluted with 3,0M NaCl showed electrophoretic migration in different buffer systems a single band with a behaviour intermediate between those of mammalian HEP and HS. The main products obtained from Artemia heparinoids after enzymatic degradation with heparitinases I and II from F. heparinum were N-sulphated disaccharides (∆U-GlcNS,6S/ ∆U,2S-GlcNS and ∆U-GlcNS) and N-acetylated disaccharides (∆U, GlcNAc). This heparinoid had a lower hemorrhagic effect (400μg/ml) when compared to unfractiionated heparins(25μg/ml).The results also suggest a negligible APTT activity of this heparinoid (62.2s). No action was observed on PT indicating that F-3.0M haven t action on the extrinsic pathway. The results showed that the fraction F- 3.0M have inhibitory effect on migration of leukocytes, 64.5% in the concentration of 10 μg/ml (P<0.001). The search for new heparin and/or heparan sulphates analogs devoid of anticoagulant activity is an atractive alternative and may open up a wide variety of new therapeutic applications

Purificação, caracterização e avaliação da atividade antiproliferativa de um inibidor de quimotripsina tipo kunitz de semente de Eryhrina velutina

A chymotrypsin inhibitor was purified from Erythrina velutina seeds by ammonium sulphate fractionation, affinities chromatographies on Trypsin-Sepharose, Quimotrypsin-Sepharose and reversed phase C-18 FPLC/AKTA system. The inhibitor, named EvCI, shown molecular mass of 17 kDa, as determined by SDSPAGE. 2D-PAGE showed four isoinhibitors with pI values of 4,42, 4,63, 4,83 and 5,06, with molecular mass of 17 kDa each. The aminoacid sequence of EvCI was determined by MALDI-TOF-MS and showed a high similarity with other Kunitz-type inhibitor of Erythrina variegata. EvCI competitively inhibited chymotrypsin, with Ki of 4 x10-8 M, but did not inhibited trypsin, pancreatic elastase, bromelain and papain. The inhibitory activity of EvCI was stable over wide pH and temperature ranges. In the presence of DTT 100 mM for 120 min, EvCI lost 50 % of activity. Cytotoxicity was studied in HeLa, MDA, HepG2, K562 and PC3 cells after 72-h incubation period. EvCl inhibited HeLa cells growth with an IC50 value of 50 μg/ml. Subsequent studies in HeLa cells analysis of cell death by annexin V/PI double-staining and cell cycle, using flow cytometry. The results provide evidence for a cytostatic activity of EvCl and support further studies on potential application of this inhibitors as an antiproliferative agent in combined therapy against cervical cancer

Clonagem e expressão do gene que codifica o inibidor de quimotripsina de Erythrina velutina WILLD. - caracterização e avaliação de seu potencial farmacológico

Proteinases are enzymes distributed widely founded in several organisms and perform many different functions, from maintaining homeostasis to the worsening of some diseases such as cancer, autoimmune diseases and infections. The proteins responsible of controlling the action of these enzymes are the inhibitors, that are classified based on their target proteases and are founded since simple organisms, such as bacteria, to higher organisms, such as larger plants and mammals. Plant proteinase inhibitors act by reducing or inactivating the activity of target proteases, thus, these proteins have been studied as potential tools in the treatment of diseases related to protease activities. In this context, an inhibitor of chymotrypsin from Erythrina velutina, called EvCI was previously purified and it was observed that this protein plays in vitro anticoagulant activity and anti-inflammatory activity in in vivo model. Aiming to reduce the environmental impact caused by the purification EvCI in high amounts and to facilitate the process of obtaining this protein, the recombinant chymotrypsin inhibitor from Eryhrina velutina was produced after cloning and expression in Escherichia coli. The bacteria were grown in LB medium and after induction of the expression this material was subjected to procedures for cell lysis and the product was applied on Nickel-affinity column. The proteins adsorbed were digested by thrombin and applied on Chymotrypsin-Sepharose affinity column, obtaining the purified inhibitor, named recEvCI. After electrophoresis, the recombinant inhibitor showed an approximately molecular mass of 17 kDa, and reduced the chymotrypsin and elastase activities in vitro. The recombinant inhibitor was sequenced and was found similar amino acids residues when compared to other inhibitors deposited in the database, with some modifications. recEvCI showed high stability under pH variations and reducing conditions, maintaining its activity around 80%. This protein increased the blood coagulation time in vitro by acting on the intrinsic pathway and did not show cytotoxicity against strains of mouse 3T3 fibroblasts and RAW 264.7 macrophages. recEvCI showed microbicide activity related to release of nitric oxide and consequently the activation of macrophages, futhermore having proinflammatory effects assessed by increased release of TNF-α. These results indicate that recEvCI can be biotechnologically used as a new tool in the control of coagulation-related diseases as well as can be an activating agent of the immune system in immunosuppressed individuals

Avaliação do efeito do composto tipo heparina isolado do caranguejo Chaceon fenneri na hemostasia e na morte celular

Heparin is a pharmaceutical animal widely used in medicine due to its potent anticoagulant effect. Furthermore, it has the ability to inhibit the proliferation, invasion and adhesion of cancer cells to vascular endothelium. However, its clinical applicability can be compromised by side effects such as bleeding. Thus, the search for natural compounds with low bleeding risk and possible therapeutic applicability has been targeted by several research groups. From this perspective, this study aims to evaluate the hemorrhagic and anticoagulant activities and citotoxic effect for different tumor cell lines (HeLa, B16-F10, HepG2, HS-5,) and fibroblast cells (3T3) of the Heparin-like from the crab Chaceon fenneri (HEP-like). The HEP-like was purified after proteolysis, ion-exchange chromatography, fractionation with acetone and characterized by electrophoresis (agarose gel) and enzymatic degradation. Hep-like showed eletroforetic behavior similar to mammalian heparin, and high trisulfated /Nacetylated disaccharides ratio. In addition, HEP-like presented low in vitro anticoagulant activity using aPTT and a minor hemorrhagic effect when compared to mammalian heparin. Furthermore, the HEP-like showed significant cytotoxic effect (p<0.001) on HeLa, HepG2 and B16-F10 tumor cells with IC50 values of 1000 ug/mL, after incubation for 72 hours. To assess the influence of heparin-like on the cell cycle in HeLa cells, analysis was performed by flow cytometry. The results of this analysis showed that HEP-like influence on the cell cycle increasing S phase and decreasing phase G2. Thus, these properties of HEP-like make these compounds potential therapeutic agents