Detection of alkali metal ions in DNA crystals using state-of-the-art X-ray diffraction experiments

The observation of light metal ions in nucleic acids crystals is generally a fortuitous event. Sodium ions in particular are notoriously difficult to detect because their X-ray scattering contributions are virtually identical to those of water and Na+…O distances are only slightly shorter than strong hydrogen bonds between well-ordered water molecules. We demonstrate here that replacement of Na+ by K+, Rb+ or Cs+ and precise measurements of anomalous differences in intensities provide a particularly sensitive method for detecting alkali metal ion-binding sites in nucleic acid crystals. Not only can alkali metal ions be readily located in such structures, but the presence of Rb+ or Cs+ also allows structure determination by the single wavelength anomalous diffraction technique. Besides allowing identification of high occupancy binding sites, the combination of high resolution and anomalous diffraction data established here can also pinpoint binding sites that feature only partial occupancy. Conversely, high resolution of the data alone does not necessarily allow differentiation between water and partially ordered metal ions, as demonstrated with the crystal structure of a DNA duplex determined to a resolution of 0.6 Å.

Algorithm for the detection of outliers based on the theory of rough sets

Outliers are objects that show abnormal behavior with respect to their context or that have unexpected values in some of their parameters. In decision-making processes, information quality is of the utmost importance. In specific applications, an outlying data element may represent an important deviation in a production process or a damaged sensor. Therefore, the ability to detect these elements could make the difference between making a correct and an incorrect decision. This task is complicated by the large sizes of typical databases. Due to their importance in search processes in large volumes of data, researchers pay special attention to the development of efficient outlier detection techniques. This article presents a computationally efficient algorithm for the detection of outliers in large volumes of information. This proposal is based on an extension of the mathematical framework upon which the basic theory of detection of outliers, founded on Rough Set Theory, has been constructed. From this starting point, current problems are analyzed; a detection method is proposed, along with a computational algorithm that allows the performance of outlier detection tasks with an almost-linear complexity. To illustrate its viability, the results of the application of the outlier-detection algorithm to the concrete example of a large database are presented.

Multigradient field-active contour model for multilayer boundary detection of ultrasound rectal wall image

Extraction and reconstruction of rectal wall structures from an ultrasound image is helpful for surgeons in rectal clinical diagnosis and 3-D reconstruction of rectal structures from ultrasound images. The primary task is to extract the boundary of the muscular layers on the rectal wall. However, due to the low SNR from ultrasound imaging and the thin muscular layer structure of the rectum, this boundary detection task remains a challenge. An active contour model is an effective high-level model, which has been used successfully to aid the tasks of object representation and recognition in many image-processing applications. We present a novel multigradient field active contour algorithm with an extended ability for multiple-object detection, which overcomes some limitations of ordinary active contour models—"snakes." The core part in the algorithm is the proposal of multigradient vector fields, which are used to replace image forces in kinetic function for alternative constraints on the deformation of active contour, thereby partially solving the initialization limitation of active contour for rectal wall boundary detection. An adaptive expanding force is also added to the model to help the active contour go through the homogenous region in the image. The efficacy of the model is explained and tested on the boundary detection of a ring-shaped image, a synthetic image, and an ultrasound image. The experimental results show that the proposed multigradient field-active contour is feasible for multilayer boundary detection of rectal wall

Immunochemical detection of sequence-specific modifications to DNA induced by UV light

Sequence specificity of antibodies to UV-damaged DNA has not been described previously. The antisera investigated here were specific for UV-modified DNA and were absolutely dependent upon the presence of thymine residues. Using a series of oligonucleotides in competition ELISA, increased inhibition was observed with increasing chain length of UV-polythymidylate. A minimum of three adjacent thymines was required for effective inhibition; alone, dimers of thymine were poor antigens. Although UV-irradiated poly(dC) was not antigenic, cytosines could partially replace thymines within the smallest effective epitope (T-T-T) with a high degree of sequence specificity, not previously described. The main epitope induced by UV was formed from adjacent thymines and either a 3' or a 5' pyrimidine.

Evaluation of hemifield sector analysis protocol in multifocal visual evoked potential (MFVEP) objective perimetry for the diagnosis and early detection of glaucomatous field defects

Visual field assessment is a core component of glaucoma diagnosis and monitoring, and the Standard Automated Perimetry (SAP) test is considered up until this moment, the gold standard of visual field assessment. Although SAP is a subjective assessment and has many pitfalls, it is being constantly used in the diagnosis of visual field loss in glaucoma. Multifocal visual evoked potential (mfVEP) is a newly introduced method used for visual field assessment objectively. Several analysis protocols have been tested to identify early visual field losses in glaucoma patients using the mfVEP technique, some were successful in detection of field defects, which were comparable to the standard SAP visual field assessment, and others were not very informative and needed more adjustment and research work. In this study, we implemented a novel analysis approach and evaluated its validity and whether it could be used effectively for early detection of visual field defects in glaucoma. OBJECTIVES: The purpose of this study is to examine the effectiveness of a new analysis method in the Multi-Focal Visual Evoked Potential (mfVEP) when it is used for the objective assessment of the visual field in glaucoma patients, compared to the gold standard technique. METHODS: 3 groups were tested in this study; normal controls (38 eyes), glaucoma patients (36 eyes) and glaucoma suspect patients (38 eyes). All subjects had a two standard Humphrey visual field HFA test 24-2 and a single mfVEP test undertaken in one session. Analysis of the mfVEP results was done using the new analysis protocol; the Hemifield Sector Analysis HSA protocol. Analysis of the HFA was done using the standard grading system. RESULTS: Analysis of mfVEP results showed that there was a statistically significant difference between the 3 groups in the mean signal to noise ratio SNR (ANOVA p<0.001 with a 95% CI). The difference between superior and inferior hemispheres in all subjects were all statistically significant in the glaucoma patient group 11/11 sectors (t-test p<0.001), partially significant 5/11 (t-test p<0.01) and no statistical difference between most sectors in normal group (only 1/11 was significant) (t-test p<0.9). sensitivity and specificity of the HAS protocol in detecting glaucoma was 97% and 86% respectively, while for glaucoma suspect were 89% and 79%. DISCUSSION: The results showed that the new analysis protocol was able to confirm already existing field defects detected by standard HFA, was able to differentiate between the 3 study groups with a clear distinction between normal and patients with suspected glaucoma; however the distinction between normal and glaucoma patients was especially clear and significant. CONCLUSION: The new HSA protocol used in the mfVEP testing can be used to detect glaucomatous visual field defects in both glaucoma and glaucoma suspect patient. Using this protocol can provide information about focal visual field differences across the horizontal midline, which can be utilized to differentiate between glaucoma and normal subjects. Sensitivity and specificity of the mfVEP test showed very promising results and correlated with other anatomical changes in glaucoma field loss.

Evaluation of hemifield sector analysis protocol in multifocal visual evoked potential objective perimetry for the diagnosis and early detection of glaucomatous field defects

CONCLUSIONS: The new HSA protocol used in the mfVEP testing can be applied to detect glaucomatous visual field defects in both glaucoma and glaucoma suspect patients. Using this protocol can provide information about focal visual field differences across the horizontal midline, which can be utilized to differentiate between glaucoma and normal subjects. Sensitivity and specificity of the mfVEP test showed very promising results and correlated with other anatomical changes in glaucoma field loss. PURPOSE: Multifocal visual evoked potential (mfVEP) is a newly introduced method used for objective visual field assessment. Several analysis protocols have been tested to identify early visual field losses in glaucoma patients using the mfVEP technique, some were successful in detection of field defects, which were comparable to the standard automated perimetry (SAP) visual field assessment, and others were not very informative and needed more adjustment and research work. In this study we implemented a novel analysis approach and evaluated its validity and whether it could be used effectively for early detection of visual field defects in glaucoma. METHODS: Three groups were tested in this study; normal controls (38 eyes), glaucoma patients (36 eyes) and glaucoma suspect patients (38 eyes). All subjects had a two standard Humphrey field analyzer (HFA) test 24-2 and a single mfVEP test undertaken in one session. Analysis of the mfVEP results was done using the new analysis protocol; the hemifield sector analysis (HSA) protocol. Analysis of the HFA was done using the standard grading system. RESULTS: Analysis of mfVEP results showed that there was a statistically significant difference between the three groups in the mean signal to noise ratio (ANOVA test, p < 0.001 with a 95% confidence interval). The difference between superior and inferior hemispheres in all subjects were statistically significant in the glaucoma patient group in all 11 sectors (t-test, p < 0.001), partially significant in 5 / 11 (t-test, p < 0.01), and no statistical difference in most sectors of the normal group (1 / 11 sectors was significant, t-test, p < 0.9). Sensitivity and specificity of the HSA protocol in detecting glaucoma was 97% and 86%, respectively, and for glaucoma suspect patients the values were 89% and 79%, respectively.

Waveform Detection of Conspecifics in the Weakly Electric Fish Gymnotus Carapo

Weakly electric fish use electric fields for communication and location of objects. Electroreceptors that are located around the mouth and along the length of the body are used in order to "decode" the electric organ discharge (EOD). The knollenorgan in Mormyriformes aids in distinguishing between different EODs. Gymnotiformes, however, have no such electroreceptors. How then are Gyrnnotiformes distinguishing between conspecific EODs? In this study scan sampling was investigated to determine whether Gymnotus carapo uses this mechanism to differentiate between distinct EODs. After determining whether Gymnotus carapo was discriminating between neighbor and stranger EODs, these same EODs were played to the test fish either jittered (the EOD of the test fish and that of the playback could not coincide) or non-jittered (the two EODs could coincide). The results show that the test fish was not discriminating between neighbor and stranger EODs. Thus, conclusions about the use of scan sampling by Gymnotus carapo to distinguish between EODs cannot be made.

Sensitivity and specificity of parallel or serial serological testing for detection of canine Leishmania infection

In Brazil, human and canine visceral leishmaniasis (CVL) caused by Leishmania infantum has undergone urbanisation since 1980, constituting a public health problem, and serological tests are tools of choice for identifying infected dogs. Until recently, the Brazilian zoonoses control program recommended enzyme-linked immunosorbent assays (ELISA) and indirect immunofluorescence assays (IFA) as the screening and confirmatory methods, respectively, for the detection of canine infection. The purpose of this study was to estimate the accuracy of ELISA and IFA in parallel or serial combinations. The reference standard comprised the results of direct visualisation of parasites in histological sections, immunohistochemical test, or isolation of the parasite in culture. Samples from 98 cases and 1,327 noncases were included. Individually, both tests presented sensitivity of 91.8% and 90.8%, and specificity of 83.4 and 53.4%, for the ELISA and IFA, respectively. When tests were used in parallel combination, sensitivity attained 99.2%, while specificity dropped to 44.8%. When used in serial combination (ELISA followed by IFA), decreased sensitivity (83.3%) and increased specificity (92.5%) were observed. Serial testing approach improved specificity with moderate loss in sensitivity. This strategy could partially fulfill the needs of public health and dog owners for a more accurate diagnosis of CVL.

Robotic Sensing and Manipulation of Deformable Linear Objects with Learning-based methods

Nowadays robotic applications are widespread and most of the manipulation tasks are efficiently solved. However, Deformable-Objects (DOs) still represent a huge limitation for robots. The main difficulty in DOs manipulation is dealing with the shape and dynamics uncertainties, which prevents the use of model-based approaches (since they are excessively computationally complex) and makes sensory data difficult to interpret. This thesis reports the research activities aimed to address some applications in robotic manipulation and sensing of Deformable-Linear-Objects (DLOs), with particular focus to electric wires. In all the works, a significant effort was made in the study of an effective strategy for analyzing sensory signals with various machine learning algorithms. In the former part of the document, the main focus concerns the wire terminals, i.e. detection, grasping, and insertion. First, a pipeline that integrates vision and tactile sensing is developed, then further improvements are proposed for each module. A novel procedure is proposed to gather and label massive amounts of training images for object detection with minimal human intervention. Together with this strategy, we extend a generic object detector based on Convolutional-Neural-Networks for orientation prediction. The insertion task is also extended by developing a closed-loop control capable to guide the insertion of a longer and curved segment of wire through a hole, where the contact forces are estimated by means of a Recurrent-Neural-Network. In the latter part of the thesis, the interest shifts to the DLO shape. Robotic reshaping of a DLO is addressed by means of a sequence of pick-and-place primitives, while a decision making process driven by visual data learns the optimal grasping locations exploiting Deep Q-learning and finds the best releasing point. The success of the solution leverages on a reliable interpretation of the DLO shape. For this reason, further developments are made on the visual segmentation.

Back-in-time void finder: dynamical detection of cosmic voids for precision cosmology

Cosmic voids are vast and underdense regions emerging between the elements of the cosmic web and dominating the large-scale structure of the Universe. Void number counts and density profiles have been demonstrated to provide powerful cosmological probes. Indeed, thanks to their low-density nature and they very large sizes, voids represent natural laboratories to test alternative dark energy scenarios, modifications of gravity and the presence of massive neutrinos. Despite the increasing use of cosmic voids in Cosmology, a commonly accepted definition for these objects has not yet been reached. For this reason, different void finding algorithms have been proposed during the years. Voids finder algorithms based on density or geometrical criteria are affected by intrinsic uncertainties. In recent years, new solutions have been explored to face these issues. The most interesting is based on the idea of identify void positions through the dynamics of the mass tracers, without performing any direct reconstruction of the density field. The goal of this Thesis is to provide a performing void finder algorithm based on dynamical criteria. The Back-in-time void finder (BitVF) we present use tracers as test particles and their orbits are reconstructed from their actual clustered configuration to an homogeneous and isotropic distribution, expected for the Universe early epoch. Once the displacement field is reconstructed, the density field is computed as its divergence. Consequently, void centres are identified as local minima of the field. In this Thesis work we applied the developed void finding algorithm to simulations. From the resulting void samples we computed different void statistics, comparing the results to those obtained with VIDE, the most popular void finder. BitVF proved to be able to produce a more reliable void samples than the VIDE ones. The BitVF algorithm will be a fundamental tool for precision cosmology, especially with upcoming galaxy-survey.

Detection Of Explosives On The Surface Of Banknotes By Raman Hyperspectral Imaging And Independent Component Analysis.

The aim of this study was to develop a methodology using Raman hyperspectral imaging and chemometric methods for identification of pre- and post-blast explosive residues on banknote surfaces. The explosives studied were of military, commercial and propellant uses. After the acquisition of the hyperspectral imaging, independent component analysis (ICA) was applied to extract the pure spectra and the distribution of the corresponding image constituents. The performance of the methodology was evaluated by the explained variance and the lack of fit of the models, by comparing the ICA recovered spectra with the reference spectra using correlation coefficients and by the presence of rotational ambiguity in the ICA solutions. The methodology was applied to forensic samples to solve an automated teller machine explosion case. Independent component analysis proved to be a suitable method of resolving curves, achieving equivalent performance with the multivariate curve resolution with alternating least squares (MCR-ALS) method. At low concentrations, MCR-ALS presents some limitations, as it did not provide the correct solution. The detection limit of the methodology presented in this study was 50μgcm(-2).

A screening method for detection of hexavalent chromium levels in soils

A rapid and low cost method to determine Cr(VI) in soils based upon alkaline metal extraction at room temperature is proposed as a semi-quantitative procedure to be performed in the field. A color comparison with standards with contents of Cr(VI) in the range of 10 to 150 mg kg-1 was used throughout. For the different types of soils studied, more than 75% of the fortified soluble Cr(VI) were recovered for all levels of spike tested for both the proposed and standard methods. Recoveries of 83 and 99% were obtained for the proposed and the standard methods, respectively, taking into account the analysis of a heavily contaminated soil sample.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Detection of human cytomegalovirus and Epstein-Barr virus in coronary atherosclerotic tissue

Previous studies indicated that patients with atherosclerosis are predominantly infected by human cytomegalovirus (HCMV), but rarely infected by type 1 Epstein-Barr virus (EBV-1). In this study, atheromas of 30 patients who underwent aortocoronary bypass surgery with coronary endartherectomy were tested for the presence of these two viruses. HCMV occurred in 93.3% of the samples and EBV-1 was present in 50% of them. Concurrent presence of both pathogens was detected in 43.3% of the samples.

Validity and reliability of methods for the detection of secondary caries around amalgam restorations in primary teeth

Secondary caries has been reported as the main reason for restoration replacement. The aim of this in vitro study was to evaluate the performance of different methods - visual inspection, laser fluorescence (DIAGNOdent), radiography and tactile examination - for secondary caries detection in primary molars restored with amalgam. Fifty-four primary molars were photographed and 73 suspect sites adjacent to amalgam restorations were selected. Two examiners evaluated independently these sites using all methods. Agreement between examiners was assessed by the Kappa test. To validate the methods, a caries-detector dye was used after restoration removal. The best cut-off points for the sample were found by a Receiver Operator Characteristic (ROC) analysis, and the area under the ROC curve (Az), and the sensitivity, specificity and accuracy of the methods were calculated for enamel (D2) and dentine (D3) thresholds. These parameters were found for each method and then compared by the McNemar test. The tactile examination and visual inspection presented the highest inter-examiner agreement for the D2 and D3 thresholds, respectively. The visual inspection also showed better performance than the other methods for both thresholds (Az = 0.861 and Az = 0.841, respectively). In conclusion, the visual inspection presented the best performance for detecting enamel and dentin secondary caries in primary teeth restored with amalgam.