1000 resultados para Detection dog


Relevância:

30.00% 30.00%

Publicador:

Resumo:

Patógenos transmitidos por carrapatos atingem uma variedade de hospedeiros vertebrados. Para identificar os agentes patogênicos transmitidos por carrapatos entre cães soropositivos para Leishmania infantum no município Campo Grande-MS, foi realizado um estudo sorológico e molecular para a detecção de Ehrlichia canis, Anaplasma platys e Babesia vogeli em 60 amostras de soro e baço, respectivamente. Adicionalmente, foi realizado o diagnóstico confirmatório de L. infantum por meio de técnicas sorológicas e moleculares. Também foi realizado o alinhamento e análise filogenética das sequências para indicar a identidade das espécies de parasitas que infectam esses animais. Anticorpos IgG anti-Ehrlichia spp., anti-B. vogeli e anti-L. infantum foram detectados em 39 (65%), 49 (81,6%) e 60 (100%) dos cães amostrados, respectivamente. Vinte e sete (45%), cinquenta e quatro (90%), cinquenta e três (88,3%), dois (3,3%) e um (1,6%) cães mostraram-se positivos na PCR para E. canis, Leishmania spp., Leishmania donovani complex, Babesia sp. e Anaplasma sp., respectivamente. Após o seqüenciamento, os amplicons mostraram 99% de similaridade com isolados de E. canis, B. vogeli e A. platys e Leishmania chagasi. Os resultados deste estudo indicaram que os cães soropositivos para L. infantum de Campo Grande, MS, são expostos a vários agentes transmitidos por carrapatos, e, portanto, devem ser incluídos no diagnóstico diferencial em cães com suspeita clínica de leishmaniose.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

A leishmaniose é uma importante zoonose, de caráter crônico, causada por protozoários do gênero Leishmania spp. Esta protozoose tem como principal vetor os flebotomíneos, sendo que, no Brasil, o Lutzomyia longipalpis é a principal espécie incriminada na transmissão da leishmaniose Visceral Americana. A presença do ácido desoxirribonucleico (DNA) do parasito em ectoparasitos, como carrapatos e pulgas, tem gerado especulações quanto a existência de novos vetores no ciclo da leishmaniose. Foi objetivo deste estudo relatar a detecção molecular de Leishmania spp. em uma mutuca da espécie Tabanus importunus que parasitava um cão oligossintomático infectado por Leishmania spp. A análise molecular amplificou o DNA do protozoário na cabeça, na região torácica e no abdomen do tabanídeo, resultando como positivo para complexo Leishmania. Este é o primeiro relato da presença de DNA de Leishmania spp. em insetos dipteros da espécie T. importunus.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

This study provides a comprehensive genetic overview on the endangered Italian wolf population. In particular, it focuses on two research lines. On one hand, we focalised on melanism in wolf in order to isolate a mutation related with black coat colour in canids. With several reported black individuals (an exception at European level), the Italian wolf population constituted a challenging research field posing many unanswered questions. As found in North American wolf, we reported that melanism in the Italian population is caused by a different melanocortin pathway component, the K locus, in which a beta-defensin protein acts as an alternative ligand for the Mc1r. This research project was conducted in collaboration with Prof. Gregory Barsh, Department of Genetics and Paediatrics, Stanford University. On the other hand, we performed analysis on a high number of SNPs thanks to a customized Canine microarray useful to integrate or substitute the STR markers for genotyping individuals and detecting wolf-dog hybrids. Thanks to DNA microchip technology, we obtained an impressive amount of genetic data which provides a solid base for future functional genomic studies. This study was undertaken in collaboration with Prof. Robert K. Wayne, Department of Ecology and Evolutionary Biology, University of California, Los Angeles (UCLA).

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Sperm cells need hexoses as a substrate for their function, for both the maintenance of membrane homeostasis and the movement of the tail. These cells have a peculiar metabolism that has not yet been fully understood, but it is clear that they obtain energy from hexoses through glycolisis and/or oxidative phosphorylation. Spermatozoa are in contact with different external environments, beginning from the testicular and epididymal fluid, passing to the seminal plasma and finally to the female genital tract fluids; in addition, with the spread of reproductive biotechnologies, sperm cells are diluted and stored in various media, containing different energetic substrates. To utilize these energetic sources, sperm cells, as other eukaryotic cells, have a well-constructed protein system, that is mainly represented by the GLUT family proteins. These transporters have a membrane-spanning α-helix structure and work as an enzymatic pump that permit a fast gradient dependent passage of sugar molecules through the lipidic bilayer of sperm membrane. Many GLUTs have been studied in man, bull and rat spermatozoa; the presence of some GLUTs has been also demonstrated in boar and dog spermatozoa. The aims of the present study were - to determine the presence of GLUTs 1, 2, 3, 4 and 5 in boar, horse, dog and donkey spermatozoa and to describe their localization; - to study eventual changes in GLUTs location after capacitation and acrosome reaction in boar, stallion and dog spermatozoa; - to determine possible changes in GLUTs localization after capacitation induced by insulin and IGF stimulation in boar spermatozoa; - to evaluate changes in GLUTs localization after flow-cytometric sex sorting in boar sperm cells. GLUTs 1, 2, 3 and 5 presence and localization have been demonstrated in boar, stallion, dog and donkey spermatozoa by western blotting and immunofluorescence analysis; a relocation in GLUTs after capacitation has been observed only in dog sperm cells, while no changes have been observed in the other species examined. As for boar, the stimulation of the capacitation with insulin and IGF didn’t cause any change in GLUTs localization, as well as for the flow cytometric sorting procedure. In conclusion, this study confirms the presence of GLUTs 1, 2 ,3 and 5 in boar, dog, stallion and donkey spermatozoa, while GLUT 4 seems to be absent, as a confirmation of other studies. Only in dog sperm cells capacitating conditions induce a change in GLUTs distribution, even if the physiological role of these changes should be deepened.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

INTRODUCTION: Cadaver dogs are known as valuable forensic tools in crime scene investigations. Scientific research attempting to verify their value is largely lacking, specifically for scents associated with the early postmortem interval. The aim of our investigation was the comparative evaluation of the reliability, accuracy, and specificity of three cadaver dogs belonging to the Hamburg State Police in the detection of scents during the early postmortem interval. MATERIAL AND METHODS: Carpet squares were used as an odor transporting media after they had been contaminated with the scent of two recently deceased bodies (PMI<3h). The contamination occurred for 2 min as well as 10 min without any direct contact between the carpet and the corpse. Comparative searches by the dogs were performed over a time period of 65 days (10 min contamination) and 35 days (2 min contamination). RESULTS: The results of this study indicate that the well-trained cadaver dog is an outstanding tool for crime scene investigation displaying excellent sensitivity (75-100), specificity (91-100), and having a positive predictive value (90-100), negative predictive value (90-100) as well as accuracy (92-100).

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Leptospirosis is a global zoonotic disease. Pathogenic Leptospira species, the causative agent of leptospirosis, colonize the renal tubules of chronically infected maintenance hosts such as dogs, rats and cattle. Maintenance hosts typically remain clinically asymptomatic and shed leptospires into the environment via urine. In contrast, accidental hosts such as humans can suffer severe acute forms of the disease. Infection results from direct contact with infected urine or indirectly, through contaminated water sources. In this study, a quantitative real-time PCR specific for lipL32 was designed to detect the urinary shedding of leptospires from dogs. The sensitivity and specificity of the assay was evaluated using both a panel of pathogenic Leptospira species and clinical microbial isolates, and samples of urine collected from experimentally infected rats and non-infected controls. The lower limit of detection was approximately 3 genome equivalents per reaction. The assay was applied to canine urine samples collected from local dog sanctuaries and the University Veterinary Hospital (UVH) at University College Dublin. Of 525 canine urine samples assayed, 37 were positive, indicating a prevalence of urinary shedding of leptospires of 7.05%. These results highlight the need to provide effective canine vaccination strategies and raise public health awareness.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Leptospiral pulmonary haemorrhage syndrome (LPHS) is a severe form of leptospirosis. Pathogenic mechanisms are poorly understood. Lung tissues from 26 dogs with LPHS, 5 dogs with pulmonary haemorrhage due to other causes and 6 healthy lungs were labelled for IgG (n=26), IgM (n=25) and leptospiral antigens (n=26). Three general staining patterns for IgG/IgM were observed in lungs of dogs with LPHS with most tissues showing more than one staining pattern: (1) alveolar septal wall staining, (2) staining favouring alveolar surfaces and (3) staining of intra-alveolar fluid. Healthy control lung showed no staining, whereas haemorrhagic lung from dogs not infected with Leptospira showed staining of intra-alveolar fluid and occasionally alveolar septa. Leptospiral antigens were not detected. We conclude that deposition of IgG/IgM is demonstrable in the majority of canine lungs with naturally occurring LPHS, similar to what has been described in other species. Our findings suggest involvement of the host humoral immunity in the pathogenesis of LPHS and provide further evidence to support the dog as a natural disease model for human LPHS.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Tick-borne encephalitis (TBE) is one of the most dangerous human neurological infections occurring in Europe and Northern parts of Asia with thousands of cases and millions vaccinated against it. The risk of TBE might be assessed through analyses of the samples taken from wildlife or from animals which are in close contact with humans. Dogs have been shown to be a good sentinel species for these studies. Serological assays for diagnosis of TBE in dogs are mainly based on purified and inactivated TBEV antigens. Here we describe novel dog anti-TBEV IgG monoclonal antibody (MAb)-capture assay which is based on TBEV prME subviral particles expressed in mammalian cells from Semliki Forest virus (SFV) replicon as well as IgG immunofluorescence assay (IFA) which is based on Vero E6 cells transfected with the same SFV replicon. We further demonstrate their use in a small-scale TBEV seroprevalence study of dogs representing different regions of Finland. Altogether, 148 dog serum samples were tested by novel assays and results were compared to those obtained with a commercial IgG enzyme immunoassay (EIA), hemagglutination inhibition test and IgG IFA with TBEV infected cells. Compared to reference tests, the sensitivities of the developed assays were 90-100% and the specificities of the two assays were 100%. Analysis of the dog serum samples showed a seroprevalence of 40% on Åland Islands and 6% on Southwestern archipelago of Finland. In conclusion, a specific and sensitive EIA and IFA for the detection of IgG antibodies in canine sera were developed. Based on these assays the seroprevalence of IgG antibodies in dogs from different regions of Finland was assessed and was shown to parallel the known human disease burden as the Southwestern archipelago and Åland Islands in particular had considerable dog TBEV antibody prevalence and represent areas with high risk of TBE for humans.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

In Brazil, human and canine visceral leishmaniasis (CVL) caused by Leishmania infantum has undergone urbanisation since 1980, constituting a public health problem, and serological tests are tools of choice for identifying infected dogs. Until recently, the Brazilian zoonoses control program recommended enzyme-linked immunosorbent assays (ELISA) and indirect immunofluorescence assays (IFA) as the screening and confirmatory methods, respectively, for the detection of canine infection. The purpose of this study was to estimate the accuracy of ELISA and IFA in parallel or serial combinations. The reference standard comprised the results of direct visualisation of parasites in histological sections, immunohistochemical test, or isolation of the parasite in culture. Samples from 98 cases and 1,327 noncases were included. Individually, both tests presented sensitivity of 91.8% and 90.8%, and specificity of 83.4 and 53.4%, for the ELISA and IFA, respectively. When tests were used in parallel combination, sensitivity attained 99.2%, while specificity dropped to 44.8%. When used in serial combination (ELISA followed by IFA), decreased sensitivity (83.3%) and increased specificity (92.5%) were observed. Serial testing approach improved specificity with moderate loss in sensitivity. This strategy could partially fulfill the needs of public health and dog owners for a more accurate diagnosis of CVL.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

To assess binocular detection grating acuity using the LEA GRATINGS test to establish age-related norms in healthy infants during their first 3 months of life. In this prospective, longitudinal study of healthy infants with clear red reflex at birth, responses to gratings were measured at 1, 2, and 3 months of age using LEA gratings at a distance of 28 cm. The results were recorded as detection grating acuity values, which were arranged in frequency tables and converted to a one-octave scale for statistical analysis. For the repeated measurements, analysis of variance (ANOVA) was used to compare the detection grating acuity results between ages. A total of 133 infants were included. The binocular responses to gratings showed development toward higher mean values and spatial frequencies, ranging from 0.55 ± 0.70 cycles per degree (cpd), or 1.74 ± 0.21 logMAR, in month 1 to 3.11 ± 0.54 cpd, or 0.98 ± 0.16 logMAR, in month 3. Repeated ANOVA indicated differences among grating acuity values in the three age groups. The LEA GRATINGS test allowed assessment of detection grating acuity and its development in a cohort of healthy infants during their first 3 months of life.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A novel capillary electrophoresis method using capacitively coupled contactless conductivity detection is proposed for the determination of the biocide tetrakis(hydroxymethyl)phosphonium sulfate. The feasibility of the electrophoretic separation of this biocide was attributed to the formation of an anionic complex between the biocide and borate ions in the background electrolyte. Evidence of this complex formation was provided by (11) B NMR spectroscopy. A linear relationship (R(2) = 0.9990) between the peak area of the complex and the biocide concentration (50-900 μmol/L) was found. The limit of detection and limit of quantification were 15.0 and 50.1 μmol/L, respectively. The proposed method was applied to the determination of tetrakis(hydroxymethyl)phosphonium sulfate in commercial formulations, and the results were in good agreement with those obtained by the standard iodometric titration method. The method was also evaluated for the analysis of tap water and cooling water samples treated with the biocide. The results of the recovery tests at three concentration levels (300, 400, and 600 μmol/L) varied from 75 to 99%, with a relative standard deviation no higher than 9%.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Infections of the central nervous systems (CNS) present a diagnostic problem for which an accurate laboratory diagnosis is essential. Invasive practices, such as cerebral biopsy, have been replaced by obtaining a polymerase chain reaction (PCR) diagnosis using cerebral spinal fluid (CSF) as a reference method. Tests on DNA extracted from plasma are noninvasive, thus avoiding all of the collateral effects and patient risks associated with CSF collection. This study aimed to determine whether plasma can replace CSF in nested PCR analysis for the detection of CNS human herpesvirus (HHV) diseases by analysing the proportion of patients whose CSF nested PCR results were positive for CNS HHV who also had the same organism identified by plasma nested PCR. In this study, CSF DNA was used as the gold standard, and nested PCR was performed on both types of samples. Fifty-two patients with symptoms of nervous system infection were submitted to CSF and blood collection. For the eight HHV, one positive DNA result-in plasma and/or CSF nested PCR-was considered an active HHV infection, whereas the occurrence of two or more HHVs in the same sample was considered a coinfection. HHV infections were positively detected in 27/52 (51.9%) of the CSF and in 32/52 (61.5%) of the plasma, difference not significant, thus nested PCR can be performed on plasma instead of CSF. In conclusion, this findings suggest that plasma as a useful material for the diagnosis of cases where there is any difficulty to perform a CSF puncture.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The aim of this study was to develop a methodology using Raman hyperspectral imaging and chemometric methods for identification of pre- and post-blast explosive residues on banknote surfaces. The explosives studied were of military, commercial and propellant uses. After the acquisition of the hyperspectral imaging, independent component analysis (ICA) was applied to extract the pure spectra and the distribution of the corresponding image constituents. The performance of the methodology was evaluated by the explained variance and the lack of fit of the models, by comparing the ICA recovered spectra with the reference spectra using correlation coefficients and by the presence of rotational ambiguity in the ICA solutions. The methodology was applied to forensic samples to solve an automated teller machine explosion case. Independent component analysis proved to be a suitable method of resolving curves, achieving equivalent performance with the multivariate curve resolution with alternating least squares (MCR-ALS) method. At low concentrations, MCR-ALS presents some limitations, as it did not provide the correct solution. The detection limit of the methodology presented in this study was 50μgcm(-2).

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A rapid and low cost method to determine Cr(VI) in soils based upon alkaline metal extraction at room temperature is proposed as a semi-quantitative procedure to be performed in the field. A color comparison with standards with contents of Cr(VI) in the range of 10 to 150 mg kg-1 was used throughout. For the different types of soils studied, more than 75% of the fortified soluble Cr(VI) were recovered for all levels of spike tested for both the proposed and standard methods. Recoveries of 83 and 99% were obtained for the proposed and the standard methods, respectively, taking into account the analysis of a heavily contaminated soil sample.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.