992 resultados para Defect Detection


Relevância:

30.00% 30.00%

Publicador:

Resumo:

Iatrogenic atrial septal defects are described in 2 patients. They occurred after implantation of Amplatzer occluders to close a patent foramen ovale. While device erosions to the extra-atrial space have been described, erosion induced atrial septal defects are a new medical entity. They may be fairly common in the situation of an atrial septal aneurysm whipping the rim of the device incessantly. They are clinically silent and benign and require echocardiography for detection. A second device solved the problem in the cases described.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

We have developed a novel way to assess the mutagenicity of environmentally important metal carcinogens, such as nickel, by creating a positive selection system based upon the conditional expression of a retroviral transforming gene. The target gene is the v-mos gene in MuSVts110, a murine retrovirus possessing a growth temperature dependent defect in expression of the transforming gene due to viral RNA splicing. In normal rat kidney cells infected with MuSVts110 (6m2 cells), splicing of the MuSVts110 RNA to form the mRNA from which the transforming protein, p85$\sp{\rm gag-mos}$, is translated is growth-temperature dependent, occurring at 33 C and below but not at 39 C and above. This splicing "defect" is mediated by cis-acting viral sequences. Nickel chloride treatment of 6m2 cells followed by growth at 39 C, allowed the selection of "revertant" cells which constitutively express p85$\sp{\rm gag-mos}$ due to stable changes in the viral RNA splicing phenotype, suggesting that nickel, a carcinogen whose mutagenicity has not been well established, could induce mutations in mammalian genes. We also show by direct sequencing of PCR-amplified integrated MuSVts110 DNA from a 6m2 nickel-revertant cell line that the nickel-induced mutation affecting the splicing phenotype is a cis-acting 70-base duplication of a region of the viral DNA surrounding the 3$\sp\prime$ splice site. These findings provide the first example of the molecular basis for a nickel-induced DNA lesion and establish the mutagenicity of this potent carcinogen. ^

Relevância:

30.00% 30.00%

Publicador:

Resumo:

National Highway Traffic Safety Administration, Office of Research and Development, Washington, D.C.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

This thesis considers two basic aspects of impact damage in composite materials, namely damage severity discrimination and impact damage location by using Acoustic Emissions (AE) and Artificial Neural Networks (ANNs). The experimental work embodies a study of such factors as the application of AE as Non-destructive Damage Testing (NDT), and the evaluation of ANNs modelling. ANNs, however, played an important role in modelling implementation. In the first aspect of the study, different impact energies were used to produce different level of damage in two composite materials (T300/914 and T800/5245). The impacts were detected by their acoustic emissions (AE). The AE waveform signals were analysed and modelled using a Back Propagation (BP) neural network model. The Mean Square Error (MSE) from the output was then used as a damage indicator in the damage severity discrimination study. To evaluate the ANN model, a comparison was made of the correlation coefficients of different parameters, such as MSE, AE energy, AE counts, etc. MSE produced an outstanding result based on the best performance of correlation. In the second aspect, a new artificial neural network model was developed to provide impact damage location on a quasi-isotropic composite panel. It was successfully trained to locate impact sites by correlating the relationship between arriving time differences of AE signals at transducers located on the panel and the impact site coordinates. The performance of the ANN model, which was evaluated by calculating the distance deviation between model output and real location coordinates, supports the application of ANN as an impact damage location identifier. In the study, the accuracy of location prediction decreased when approaching the central area of the panel. Further investigation indicated that this is due to the small arrival time differences, which defect the performance of ANN prediction. This research suggested increasing the number of processing neurons in the ANNs as a practical solution.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

An unusual presentation of a focal osteoporotic bone marrow defect (FOBMD) of the mandible mimicking a cystic lesion is documented. A definitive diagnosis could be established only on the basis of the histopathologic evaluation. A 66-year-old Brazilian woman was referred by her dentist for well-defined radiolucency of the mandibular molar region suggesting a cystic lesion of odontogenic origin. The computed tomography scan confirmed that the lesion did not affect the corticals. The biopsy confirmed the diagnosis of FOBMD. The diagnostic difficulty in the current case is obvious, because FOBMD, usually exhibiting an ill-defined radiolucency, is seldom suspected preoperatively when a differential diagnosis is considered for focal well-defined radiolucent areas in the jaws.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

To assess binocular detection grating acuity using the LEA GRATINGS test to establish age-related norms in healthy infants during their first 3 months of life. In this prospective, longitudinal study of healthy infants with clear red reflex at birth, responses to gratings were measured at 1, 2, and 3 months of age using LEA gratings at a distance of 28 cm. The results were recorded as detection grating acuity values, which were arranged in frequency tables and converted to a one-octave scale for statistical analysis. For the repeated measurements, analysis of variance (ANOVA) was used to compare the detection grating acuity results between ages. A total of 133 infants were included. The binocular responses to gratings showed development toward higher mean values and spatial frequencies, ranging from 0.55 ± 0.70 cycles per degree (cpd), or 1.74 ± 0.21 logMAR, in month 1 to 3.11 ± 0.54 cpd, or 0.98 ± 0.16 logMAR, in month 3. Repeated ANOVA indicated differences among grating acuity values in the three age groups. The LEA GRATINGS test allowed assessment of detection grating acuity and its development in a cohort of healthy infants during their first 3 months of life.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A novel capillary electrophoresis method using capacitively coupled contactless conductivity detection is proposed for the determination of the biocide tetrakis(hydroxymethyl)phosphonium sulfate. The feasibility of the electrophoretic separation of this biocide was attributed to the formation of an anionic complex between the biocide and borate ions in the background electrolyte. Evidence of this complex formation was provided by (11) B NMR spectroscopy. A linear relationship (R(2) = 0.9990) between the peak area of the complex and the biocide concentration (50-900 μmol/L) was found. The limit of detection and limit of quantification were 15.0 and 50.1 μmol/L, respectively. The proposed method was applied to the determination of tetrakis(hydroxymethyl)phosphonium sulfate in commercial formulations, and the results were in good agreement with those obtained by the standard iodometric titration method. The method was also evaluated for the analysis of tap water and cooling water samples treated with the biocide. The results of the recovery tests at three concentration levels (300, 400, and 600 μmol/L) varied from 75 to 99%, with a relative standard deviation no higher than 9%.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Infections of the central nervous systems (CNS) present a diagnostic problem for which an accurate laboratory diagnosis is essential. Invasive practices, such as cerebral biopsy, have been replaced by obtaining a polymerase chain reaction (PCR) diagnosis using cerebral spinal fluid (CSF) as a reference method. Tests on DNA extracted from plasma are noninvasive, thus avoiding all of the collateral effects and patient risks associated with CSF collection. This study aimed to determine whether plasma can replace CSF in nested PCR analysis for the detection of CNS human herpesvirus (HHV) diseases by analysing the proportion of patients whose CSF nested PCR results were positive for CNS HHV who also had the same organism identified by plasma nested PCR. In this study, CSF DNA was used as the gold standard, and nested PCR was performed on both types of samples. Fifty-two patients with symptoms of nervous system infection were submitted to CSF and blood collection. For the eight HHV, one positive DNA result-in plasma and/or CSF nested PCR-was considered an active HHV infection, whereas the occurrence of two or more HHVs in the same sample was considered a coinfection. HHV infections were positively detected in 27/52 (51.9%) of the CSF and in 32/52 (61.5%) of the plasma, difference not significant, thus nested PCR can be performed on plasma instead of CSF. In conclusion, this findings suggest that plasma as a useful material for the diagnosis of cases where there is any difficulty to perform a CSF puncture.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The aim of this study was to develop a methodology using Raman hyperspectral imaging and chemometric methods for identification of pre- and post-blast explosive residues on banknote surfaces. The explosives studied were of military, commercial and propellant uses. After the acquisition of the hyperspectral imaging, independent component analysis (ICA) was applied to extract the pure spectra and the distribution of the corresponding image constituents. The performance of the methodology was evaluated by the explained variance and the lack of fit of the models, by comparing the ICA recovered spectra with the reference spectra using correlation coefficients and by the presence of rotational ambiguity in the ICA solutions. The methodology was applied to forensic samples to solve an automated teller machine explosion case. Independent component analysis proved to be a suitable method of resolving curves, achieving equivalent performance with the multivariate curve resolution with alternating least squares (MCR-ALS) method. At low concentrations, MCR-ALS presents some limitations, as it did not provide the correct solution. The detection limit of the methodology presented in this study was 50μgcm(-2).

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A rapid and low cost method to determine Cr(VI) in soils based upon alkaline metal extraction at room temperature is proposed as a semi-quantitative procedure to be performed in the field. A color comparison with standards with contents of Cr(VI) in the range of 10 to 150 mg kg-1 was used throughout. For the different types of soils studied, more than 75% of the fortified soluble Cr(VI) were recovered for all levels of spike tested for both the proposed and standard methods. Recoveries of 83 and 99% were obtained for the proposed and the standard methods, respectively, taking into account the analysis of a heavily contaminated soil sample.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

O presente trabalho versa sobre o diagnóstico e a abordagem ortodôntica das anomalias dentárias, enfatizando os aspectos etiológicos que definem tais irregularidades de desenvolvimento. Parece existir uma inter-relação genética na determinação de algumas dessas anomalias, considerando-se a alta frequência de associações. Um mesmo defeito genético pode originar diferentes manifestações fenotípicas, incluindo agenesias, microdontias, ectopias e atraso no desenvolvimento dentário. As implicações clínicas das anomalias dentárias associadas são muito relevantes, uma vez que o diagnóstico precoce de uma determinada anomalia dentária pode alertar o clínico sobre a possibilidade de desenvolvimento de outras anomalias associadas no mesmo paciente ou em outros membros da família, permitindo a intervenção ortodôntica em época oportuna.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Previous studies indicated that patients with atherosclerosis are predominantly infected by human cytomegalovirus (HCMV), but rarely infected by type 1 Epstein-Barr virus (EBV-1). In this study, atheromas of 30 patients who underwent aortocoronary bypass surgery with coronary endartherectomy were tested for the presence of these two viruses. HCMV occurred in 93.3% of the samples and EBV-1 was present in 50% of them. Concurrent presence of both pathogens was detected in 43.3% of the samples.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Secondary caries has been reported as the main reason for restoration replacement. The aim of this in vitro study was to evaluate the performance of different methods - visual inspection, laser fluorescence (DIAGNOdent), radiography and tactile examination - for secondary caries detection in primary molars restored with amalgam. Fifty-four primary molars were photographed and 73 suspect sites adjacent to amalgam restorations were selected. Two examiners evaluated independently these sites using all methods. Agreement between examiners was assessed by the Kappa test. To validate the methods, a caries-detector dye was used after restoration removal. The best cut-off points for the sample were found by a Receiver Operator Characteristic (ROC) analysis, and the area under the ROC curve (Az), and the sensitivity, specificity and accuracy of the methods were calculated for enamel (D2) and dentine (D3) thresholds. These parameters were found for each method and then compared by the McNemar test. The tactile examination and visual inspection presented the highest inter-examiner agreement for the D2 and D3 thresholds, respectively. The visual inspection also showed better performance than the other methods for both thresholds (Az = 0.861 and Az = 0.841, respectively). In conclusion, the visual inspection presented the best performance for detecting enamel and dentin secondary caries in primary teeth restored with amalgam.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Onion (Allium cepa) is one of the most cultivated and consumed vegetables in Brazil and its importance is due to the large laborforce involved. One of the main pests that affect this crop is the Onion Thrips (Thrips tabaci), but the spatial distribution of this insect, although important, has not been considered in crop management recommendations, experimental planning or sampling procedures. Our purpose here is to consider statistical tools to detect and model spatial patterns of the occurrence of the onion thrips. In order to characterize the spatial distribution pattern of the Onion Thrips a survey was carried out to record the number of insects in each development phase on onion plant leaves, on different dates and sample locations, in four rural properties with neighboring farms under different infestation levels and planting methods. The Mantel randomization test proved to be a useful tool to test for spatial correlation which, when detected, was described by a mixed spatial Poisson model with a geostatistical random component and parameters allowing for a characterization of the spatial pattern, as well as the production of prediction maps of susceptibility to levels of infestation throughout the area.