963 resultados para Control agent
Resumo:
Abstract The plasmid pME6863, carrying the aiiA gene from the soil bacterium Bacillus sp. A24 that encodes a lactonase enzyme able to degrade N-acyl-homoserine lactones (AHLs), was introduced into the rhizosphere isolate Pseudomonas fluorescens P3. This strain is not an effective biological control agent against plant pathogens. The transformant P. fluorescens P3/pME6863 acquired the ability to degrade AHLs. In planta, P. fluorescens P3/pME6863 significantly reduced potato soft rot caused by Erwinia carotovora and crown gall of tomato caused by Agrobacterium tumefaciens to a similar level as Bacillus sp. A24. Little or no disease reduction was observed for the wild-type strain P3 carrying the vector plasmid without aiiA. Suppression of potato soft rot was observed even when the AHL-degrading P. fluorescens P3/pME6863 was applied to tubers 2 days after the pathogen, indicating that biocontrol was not only preventive but also curative. When antagonists were applied individually with the bacterial plant pathogens, biocontrol activity of the AHL degraders was greater than that observed with several Pseudomonas 2,4-diacetylphloroglucinol-producing strains and with Pseudomonas chlororaphis PCL1391, which relies on production of phenazine antibiotic for disease suppression. Phenazine production by this well characterized biological control strain P. chlororaphis PCL1391 is regulated by AHL-mediated quorum sensing. When P. chlororaphis PCL1391 was co-inoculated with P. fluorescens P3/pME6863 in a strain mixture, the AHL degrader interfered with the normally excellent ability of the antibiotic producer to suppress tomato vascular wilt caused by Fusarium oxysporum f. sp. lycopersici. Our results demonstrate AHL degradation as a novel biocontrol mechanism, but also demonstrate the potential for non-target interactions that can interfere with the biocontrol efficacy of other strains.
Resumo:
El principal objectiu d'aquest treball ha estat estudiar la producció de metabòlits amb activitat antibiòtica per soques de l'espècie Pseudomonas fluorescens de la col·lecció EPS, i també avaluar la seva potencialitat com a agents de biocontrol. Es va disposar també de diverses soques de P. fluorescens, cedides per altres investigadors, que van utilitzar-se com a referència perquè algunes són actives en control biològic i produeixen metabòlits secundaris d'interès en el biocontrol de malalties de plantes. La present memòria s'estructura en cinc capítols, que són, introducció al control biològic, descripció de l'etapa de selecció de soques i cerca dels metabòlits produïts, estudi de la producció d'HCN per la soca EPS288, estudi de la producció de l'antibiòtic 2,4-diacetilfloroglucinol (DAPG), i finalment, el darrer capítol, on s'ha estudiat la producció de DAPG sobre material vegetal i la capacitat de colonitzar arrels per diverses soques d'interès. En l'etapa de prospecció, va demostrar-se que un 37% del total de les soques de la col·lecció EPS produïen HCN, totes de l'espècie P. fluorescens, i un 90% d'aquestes provenien de les arrels de plantes. Es va confirmar la producció dels metabòlits secundaris 2,4-diacetilfloroglucinol, àcid fenazina-1-carboxílic, i pirrolnitrina, per diverses soques de la col·lecció EPS seleccionades mitjançant tècniques moleculars. Així, de la col·lecció EPS, les soques EPS317 i EPS808 produeixen DAPG, la EPS263 àcid fenazina-1-carboxílic i pirrolnitrina i, EPS894, EPS895, EPS945 produeixen àcid fenazina-1-carboxílic. La producció d'HCN es va estudiar més exhaustivament en la soca EPS288, seleccionada per la seva activitat antifúngica i candidata a agent de biocontrol contra Stemphylium vesicarium, causant de la estemfiliosi de la perera, i contra Penicillium expansum, causant de la podridura blava en conservació de fruita a postcollita. Per aquest estudi, es va dissenyar i validar un sistema per recollir l'HCN a partir de cultius en medi líquid. S'ha demostrat que la temperatura d'incubació, la concentració cel·lular de sembra i la composició del medi de cultiu afectaven a la producció d'HCN. Els medis complexos i la glicina n'afavorien la síntesi i la font de carboni no afectava. La soca EPS288 va produir més HCN que P. fluorescens CHA0, soca de referència productora d'HCN i descrita com a activa en processos de biocontrol de fongs fitopatògens. En l'estudi de la producció de DAPG, les soques de la col·lecció EPS i de referència, es van comparar en diversos medis de cultiu estudiant l'efecte de la complexitat i consistència del medi, i l'addició de ferro o de glucosa. Va demostrar-se que la producció de DAPG depèn principalment de la soca i de les característiques del medi de cultiu. La glucosa estimula la producció, mentre que el ferro pràcticament no afecta, i en general, el medi sòlid i complex estimula la producció de DAPG. Tanmateix, aquests efectes varien en alguna de les soques assajades donant lloc a comportaments singulars. En el seguiment del creixement amb un sistema automàtic es va comprovar que la velocitat específica de creixement i la concentració cel·lular assolida al final del cultiu, estaven condicionades per la composició del medi de cultiu. En les proves d'antagonisme vers fitopatògens que foren seleccionats com a indicadors, va observar-se que tant l'antagonisme in vitro com la inhibició d'infeccions sobre material vegetal estaven parcialment relacionades amb la producció dels metabòlits secundaris estudiats. La promoció del creixement de portaempelts per aquestes soques depenia de la soca i de l'hoste, però no es pogué establir una relació causa-efecte amb el metabòlits produïts. També es va comprovar que algunes de les soques podien sobreviure en ferides de pomes i de peres, on produïren DAPG. Mutants resistents a rifampicina de diverses soques de la col·lecció EPS i de referència es van inocular en llavors de pomera i de tomatera que es van sembrar i incubar en condicions controlades. Es va fer el seguiment de la població bacteriana total i resistent a rifampicina present a les arrels durant 72 dies. Totes les soques van colonitzar les arrels de les plantes, mantenint una elevada població durant 37 dies, cap d'elles va estimular el creixement ni mostrar efectes fitotòxics, no afectant tampoc signicativament a la població bacteriana espontània de les arrels. La soca EPS808, una de les seleccionades pel treball, va aconseguir uns nivells de producció de DAPG, una velocitat de creixement i una supervivència relativa a les arrels similar a altres soques de referència descrites com a bons agents de biocontrol. En conseqüència, se la considera una candidata a agent de biocontrol que hauria de ser objecte de futurs estudis d'eficàcia.
Resumo:
El fuego bacteriano, causado por Erwinia amylovora, es una enfermedad muy importante a nivel comercial y económico porque afecta a plantas de la familia de las rosáceas y es especialmente agresiva en manzano (Pyrus malus) y peral (Pyrus communis), así como en plantas ornamentales (Crataegus, Cotoneaster o Pyracantha). Esta enfermedad está distribuida por todo el mundo en zonas climáticas templadas de Amércia del Norte, Nueva Zelanda, Japón, Israel, Turquí y Europa. En España, el fuego bacteriano fue detectado por primera vez en 1995 en el norte del País (Euskadi) y más tarde en nuevos focos aparecidos en otras áreas. La enfermedad puede ser controlada comercialmente mediante la aplicación de pesticidas quimicos (derivados de cobre, antibioticos). Sin embargo, muchos de los productos químicos presentan baja actividad o causan fitotoxicidad, y la estreptomicina, el producto más eficaz, esta prohibido en muchos países, incluyendo España. Por tanto, en ausencia de apropiados agentes químicos, el control biológico se contempla como una buena alternativa. En el presente trabajo, un agente de control biológico, Pseudomonas fluorescens EPS62e, ha sido seleccionada de entre 600 aislados de las especies P. fluorescens y Pantoea agglomerans obtenidos de flores, frutos y hojas de plantas de la familia de las rosáceas durante una prospección llevada a cabo en varias áreas geográficas de España. La cepa ha sido seleccionada por su capacidad de suprimir la infecciones producidas por E. amylovora frutos inmaduros, flores y brotes de peral en condiciones de ambiente controlado, presentando unos niveles de control similares a los obtenidos mediante el control químico usando derivados de cobre o antibióticos. La cepa además ha mostrado la capacidad de colonizar y sobrevivir en flores y heridas producidas en frutos inmaduros en condiciones de ambiento controlado pero también en flores en condiciones de campo. La exclusión de E. amylovora medinate la colonización de la superficie, el consumo de nutrientes, y la interacción entre las células del patógeno y del agente de biocontrol es la principal causa de la inhibición del fuego bacteriano por la cepa EPS62e. Estas características constituyen aspectos interesantes para un desarrollo efectivo de la cepa EPS62e como un agente de biocontrol del fuego bacteriano en condiciones comerciales.
Resumo:
In dual cultures, the supernatant filtrate of the biological control agent Bacillus subtilis was evaluated against (Fusarium oxysporum f.sp. lentis) the causal organism of lentil vascular wilt. The antagonistic activity was evaluated as percent reduction of fungal growth (certainly due, in part, to the antifungal metabolites produced by the antagonistic bacterium). The in-vitro experiments showed that B. subtilis filtrate, whether solid or liquid media, had a strong inhibiting activity on the spore germination and mycelial growth of F. oxysporum f. sp. lentis. In a glasshouse experiment, soil was drenched with B. subtilis filtrate at 30 ml/kg (vol/wt) around seedlings of a susceptible lentil line (ILL 4605). In this treatment there was only 31% mortality compared with 100% kill of plants in the control treatment (P≤0.05).
Resumo:
Larvae of Sciaridae flies (Diptera) cause considerable damage to the mushroom Agaricus blazei (Murrill) ss. Heinemann in Brazil. Brazilian growers have had considerable difficulties in controlling this pest. The objective of this work was to test the effect of the predatory Laelapidae mite Stratiolaelaps scimitus (Womersley) as a control agent of Bradysia matogrossensis (Lane) in cultures of A. blazei. The work corresponded to an evaluation of the efficiency of that predator when released in boxes containing each about 15 L of commercial mushroom compost naturally infested with the pest. The results showed a significant effect of that predator on the population of B. matogrossensis. The release of either 665 or 1330 S. scimitus per box significantly reduced the pest population to levels that, according to grower's experience, apparently could not cause considerable damage. The positive results obtained warrant the conduction of complementary studies to determine the lowest rates of the predator that could still produce acceptable levels of control.
Resumo:
Supervising and controlling the many processes involved in petroleum production is both dangerous and complex. Herein, we propose a multiagent supervisory and control system for handle continuous processes like those in chemical and petroleum industries In its architeture, there are agents responsible for managing data production and analysis, and also the production equipments. Fuzzy controllers were used as control agents. The application of a fuzzy control system to managing an off-shore installation for petroleum production onto a submarine separation process is described. © 2008 IEEE.
Resumo:
Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)
Resumo:
Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)
Resumo:
Survival of the free-living mycetophagous form of Deladenus siricidicola, the major biological control agent of Sirex woodwasp, Sirex noctilio, was tested in known (Pinus taeda) and predicted novel (P. elliottii subsp. elliottii × P. caribaea var. hondurensis) hybrid host taxa. Trials were established in the field to simulate nematode dispersal both naturally by infected wasps and following commercial inoculation, as well as in the laboratory under controlled conditions. Nematodes showed reduced survival in hybrid pine compared with P. taeda for all tree-associated treatments, but performed equivalently in petri-dish bioassays containing substrate of each taxon. Growth of Amylostereum areolatum, the food source of D. siricidicola was lower on plates containing ground hybrid substrate than on plates containing ground P. taeda. Some physical differences were found between taxa, including differences in bordered pit diameters, tracheid widths, and basic density, but these did not consistently explain reduced performance. More plant secondary compounds (predominantly oleoresins) were present in hybrid taxa than in P. taeda, and in standing trees compared with felled trees. Our results suggested that D. siricidicola may not be as effective in hybrid pine taxa for the biological control of S. noctilio as it is in its current known host taxa, possibly because of reduced growth of its food source, A. areolatum in hybrid pine.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.
Resumo:
The Neotropical lycaenid hairstreak genus Thepytus Robbins and its eight species are revised. Species treatments summarize nomenclature, distribution, habitat, behavior, and diagnostic traits, as well as noting why each species is considered distinct under a biological species concept. An identification key for males and a checklist are included. Beatheclus Balint & Dahners new synonym is synonymized with Thepytus, and Theppus beatrizae (Balint & Dahners) is a new combination. Other nomenclatural actions include the description of Thepytus jennifer Busby & Robbins new species. Thepytus nancyana Busby & Robbins new species, and Thepytus carmen Robbins & Duarte new species. A lectotype is designated or Thecla thyrea Hewitson, 1867, to ensure stability of this name. A phylogenetic analysis based on 22 coded morphological characters yields one equal weight most parsimonious 39-step tree. Implied weighting does not change the tree topology. Unambiguous changes in elevation optimized on the cladogram show that a montane lineage of Thepytus colonized the lowlands in at least one instance. The use of T. echelta (Hewitson) as a biological control agent for Psittacanthus (Loranthaceae) is discussed.
Resumo:
Neoseiulus baraki Athias-Henriot (Acari: Phytoseiidae) has been reported from the Americas, Africa and Asia, often in association with Aceria guerreronis Keifer (Acari: Eriophyidae), one of the most important pests of coconut (Cocos nucifera L.) in diVerent parts of the world. That phytoseiid has been considered one of the most common predators associated with A. guerreronis in Brazil. The objective of this study was to evaluate the feeding preference and the eVect of food items commonly present on coconut fruits and several temperature regimes on the life history of a Brazilian population of N. baraki. Completion of immature development was possible when N. baraki was fed A. guerreronis, Steneotarsonemus concavuscutum Lofego and Gondim Jr., and Tyrophagus putrescentiae (Schrank). Fecundity was highest on T. putrescentiae (39.4 eggs), followed by A. guerreronis (24.8 eggs). In choice tests, irrespective of the food on which N. baraki was reared, a larger number of adults of this predator chose leaf discs containing A. guerreronis than discs containing other food items, demonstrating a preference of the former for the latter as food. Egg to adult thermal developmental time was calculated as 84.2 degree-days, above a threshold of 15.8 degrees C. This lower developmental threshold is higher than previously published for phytoseiid species from higher latitudes. Neoseiulus baraki was shown to have higher biotic potential at 30 degrees C (r(m) 0.29). The results suggest N. baraki to be a promising biological control agent of A. guerreronis, well adapted to survive and develop in areas with relatively high temperatures, where that pest prevails.
Resumo:
Rhodacaridae are cosmopolitan mites mentioned as predators, although nothing is known about their potential as biological control agents. One of the objectives of the work reported in this paper was to evaluate the potential of Protogamasellopsis posnaniensis (Acari: Rhodacaridae) as predator of representative species of insects of the families Sciaridae (Bradysia matogrossensis (Lane)) and Thripidae (Frankliniella occidentalis (Pergande)), of mites of the family Acaridae (Tyrophagus putrescentiae (Schrank) and Rhizoglyphus echinopus (Fumouze & Robin) and of nematodes of the family Rhabditidae (Protorhabditis sp.). Another objective was to determine the biological cycle of P. posnaniensis when fed the prey on which it performed best in the preceding predation test. The study was conducted in a laboratory where the experimental units were maintained at 25 +/- 1 degrees C, 97 +/- 3% RH and in the dark. Although the predator was able to kill all prey species considered in this study, the most favorable prey were T. putrescentiae, F. occidentalis and Protorhabditis sp. Survivorship of the predator in predation tests was always 98% or higher. Life table biological parameters when the predator was fed T. putrescentiae were: R(o) = 109.29; T = 19.06 days; lambda = 1.28 e r(m) = 0.32 female/female/day. Despite preying upon larvae of B. matogrossensis, eggs of the former can also be killed by the latter. The results indicated that A posnaniensis is a promising biological control agent, deserving additional studies on its possible use for the control of soil pests. (C) 2008 Elsevier Inc. All rights reserved.
Isolation and identification of the toxic peptides from Lophyrotoma zonalis (Pergidae) sawfly larvae
Resumo:
The broad-leaved paper bark tree Melaleuca quinquenervia (Cav) (Myrtaceae) was introduced into Florida (USA) early in this century it has proliferated to such an extent that urgent measures are now required to control it. The sawfly Lophyrotoma zonalis (Pergidae) has been introduced as a possible biological control agent due to its ability to defoliate M. quinquenervia. Because toxic D-amino acid- containing peptides have been isolated from some sawfly species, L. zonalis larvae were processed using the previously reported method for the recovery of these compounds. The toxins lophyrotomin (as the free C-terminal acid) and a mixture of pergidin and Val(4)-pergidin were isolated at 0.36 and 0.43% yield of the dried larvae, respectively. Both compounds when dosed intraperitoneally to C57/B16 male mice were hepatotoxic with lowest lethal doses of 8 and 32 mg/kg, respectively. The pathology of the liver was different for each compound, with the lophyrotomin free acid causing a periportal haemorrhagic necrosis and the pergidin causing a periacinar coagulative necrosis. (C) 2001 Elsevier Science Ltd. All rights reserved.
Resumo:
Six species of insects and a rust fungus have been successfully established for biocontrol of the weed Parthenicum hysterophorus L. in Queensland, Australia. Effectiveness of biocontrol insects was evaluated at two properties in Queensland during 1996-97 based on an exclusion experiment using insecticides. Parthenium-infested plots with and without biocontrol insects were sampled at monthly intervals and the impact of biocontrol insects on parthenium at individual plant and whole population levels monitored. Biocontrol insects were more effective at Mt Panorama (central Queensland) than at Plain Creek (north Queensland). At Mt Panorama, the leaf-feeding beetle Zygogramma bicolorata Pallister caused 96% defoliation and the stem-galling moth Epiblema strenuana Walker affected 100% of the plants, resulting in reductions of 90% in weed density, 40% in plant height, and 82% in flower production. Exclusion of biocontrol insects resulted in a 52% increase in seedling emergence and a seven-fold increase in the soil seed bank in the following season. At Plain Creek, E. strenuana was the only prominent agent. It affected 92% of the plants and prevented 32% of plants from producing any flowers, reduced plant height by 40% and flower production by 49%, but did not reduce the plant biomass, weed density or soil seed bank. However, exclusion of biocontrol insects resulted in an eight-fold increase in the soil seed bank in the following season.