Persistence of conidia of Entomophthora muscae in relation to age, temperature, and humidity

In this paper, the effect of age, humidity, and temperature on the conidial survival of Entomophthora muscae was evaluated. E. muscae was obtained from Musca domestica in a dairy in Itatiba (São Paulo, Brazil) and maintained in the laboratory by continuous passage through flies. Furthermore, the ability of conidia to infect flies at three temperatures (17, 21, and 27 degrees C), four ages of conidia (12, 72, 96, and 154 hours) and two humidities (100 and 60% RH) was evaluated. The temperature of 21 degrees C was the most favorable for the infection of house flies. Humidity was a cause of variation at 27 degrees C when the conidia were up to 12 hours old, but had no effect at lower temperatures. Conidia held at 100% RH and aged 72 hours caused no infection at 17 degrees C, but were infective at 21 degrees C. In the present study, conidia retained viability much longer than previously observed. Finally, the effect of humidity, temperature, and conidial age is discussed.

Hydrophobicity and surface electrostatic charge of conidia of the mycoparasite Coniothyrium minitans

The effect of increasing culture age on cell surface hydrophobicity (CSH) and cell surface electrostatic charge (measured as zeta potential) of conidia from five isolates of Coniothyrium minitans representing three different morphological types was examined. Conidial CSH of three isolates (A2 960/1, CH1 and CH2) decreased with culture age, whereas CSH of two others (B 1300/2 and IMI 134523) remained high for the whole 42 day experimental period. In contrast, cell surface electrostatic charge decreased uniformly in conidia of all five isolates for the first 34 d and then rose slightly at 42 d. The variation in cell surface electrostatic charge (spectrum width) of the sampled conidia decreased with age for all five isolates. In all five isolates cell surface electrostatic charge of conidia became increasingly negative as the pH of the buffer used to suspend conidia was increased from pH 3.0 to 9.0. No relationship between colony morphology of C. minitans and conidial CSH and cell surface electrostatic charge was found.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Endophytic and entomopathogenic strains of Beauveria sp to control the bovine tick Rhipicephalus (Boophilus) microplus

Pathogenicity of strains of the entomopathogenic fungus Beauveria bassiana and endophytic strains of Beauveria sp against the bovine tick Rhipicephalus (Boophilus) microplus was tested in laboratory bioassays and under field conditions. Suspensions containing 10(5), 10(7) and 10(9) conidia/mL were prepared of each fungal strain for laboratory bioassays. The ticks were maintained at 28 degrees C, 90 +/- 5% relative humidity, and the following variables were evaluated: initial female weight, egg weight, hatching percentage, reproductive efficiency, and percentage control. For tests under field conditions, a Beauveria suspension containing 10(6) conidia/mL was sprayed on tick-infested cows. After 72 h, the ticks were collected to estimate mortality under field conditions. Laboratory bioassays showed a mortality of 20 to 50% of the ticks seven days after inoculation with 10(7) Beauveria conidia/mL. Under field conditions 10(6) Beauveria conidia/mL induced 18-32% mortality. All Beauveria strains were effective in biological control of R. (Boophilus) microplus under laboratory and field test conditions. This is the first demonstration that endophytic fungi can be used for biological control of the cattle tick; this could help reduce environmental contamination by diminishing the need for chemical acaricides. Two endophytic strains were isolated from maize leaves and characterized by molecular sequencing of 5.8S rDNA ITS1 and ITS2 and morphological analyses of conidia. We found that these two endophytic Beauveria isolates, designated B95 and B157, are close to Beauveria amorpha.

Impact of natural epizootics of the fungal pathogen Neozygites floridana (Zygomycetes: Entomophthorales) on population dynamics of Tetranychus evansi (Acari: Tetranychidae) in tomato and nightshade

The tomato red spider mite, Tetranychus evansi (Acari: Tetranychidae) was recently introduced in Africa and Europe, where there is an increasing interest in using natural enemies to control this pest on solanaceous crops. Two promising candidates for the control of T. evansi were identified in South America, the fungal pathogen, Neozygites floridana and the predatory mite Phytoseiulus longipes. In this study, population dynamics of T. evansi and its natural enemies together with the influence of environmental conditions on these organisms were evaluated during four crop cycles in the field and in a protected environment on nightshade and tomato plants with and without application of chemical pesticides. N. floridana was the only natural enemy found associated with T. evansi in the four crop cycles under protected environment but only in the last crop cycle in the field. In the treatments where the fungus appeared, reduction of mite populations was drastic. N. floridana appeared in tomato plants even when the population density of T. evansi was relatively low (less than 10 mites/3.14 cm(2) of leaf area) and even at this low population density, the fungus maintained infection rates greater than 50%. The application of pesticides directly affected the fungus by delaying epizootic initiation and contributing to lower infection rates than unsprayed treatments. Rainfalls did not have an apparent impact on mite populations. These results indicate that the pathogenic fungus, N. floridana can play a significant role in the population dynamics of T. evansi, especially under protected environment, and has the potential to control this pest in classical biological control programs. (C) 2009 Elsevier Inc. All rights reserved.

Molecular detection and differentiation of Brazilian and African isolates of the entomopathogen Neozygites tanajoae (Entomophthorales: Neozygitaceae) with PCR using specific primers

Neozygites tanajoae is an entomopathogenic fungus which has been used for biocontrol of the cassava green mite (Mononychellus tanajoa, CGM) in Africa. Establishment and dispersal of Brazilian isolates which have been introduced into some African countries in recent years to improve CGM control was followed with specific PCR assays. Two primer pairs, NEOSSU_F/NEOSSU_R and 8DDC_F/8DDC_R, were used to differentiate isolates collected from several locations in Brazil and from three countries in Africa, Benin, Ghana and Tanzania. The first primer pair enabled the species-specific detection of Neozygites tanajoae, while the second differentiated the Brazilian isolates from those of other geographical origin. PCR assays were designed for detection of fungal DNA in the matrix of dead infested mites since N. tanajoae is difficult to isolate and culture on selective artificial media. Our results show that all isolates (Brazilian and African) that sporulated on mummified mites were amplified with the first primer pair confirming their Neozygites tanajoae identity. The second pair amplified DNA from all the Brazilian isolates, but did not amplify any DNA samples from the African isolates. None of the two primers showed amplification neither from any of the non-sporulating mite extracts nor from the dead uninfected mites used as negative controls. We confirmed that the two primer pairs tested are suitable for the detection and differential identification of N. tanajoae isolates from Brazil and Africa and that they are useful to monitor the establishment and spread of the Brazilian isolates of N. tanajoae introduced into Benin or into other African countries for improvement of CGM biocontrol.

The effect of host plants on Tetranychus evansi, Tetranychus urticae (Acari: Tetranychidae) and on their fungal pathogen Neozygites floridana (Entomophthorales: Neozygitaceae)

In a series of tritrophic-level interaction experiments, the effect of selected host plants of the spider mites, Tetranychus evansi and Tetranychus urticae, on Neozygites floridana was studied by evaluating the attachment of capilliconidia, presence of hyphal bodies in the infected mites, mortality from fungal infection, mummification and sporulation from fungus-killed mite cadavers. Host plants tested for T. evansi were tomato, cherry tomato, eggplant, nightshade, and pepper while host plants tested for T. urticae were strawberry, jack bean, cotton and Gerbera. Oviposition rate of the mites on each plant was determined to infer host plant suitability while host-switching determined antibiosis effect on fungal activity. T. evansi had a high oviposition on eggplant, tomato and nightshade but not on cherry tomato and pepper. T. urticae on jack bean resulted in a higher oviposition than on strawberry, cotton and Gerbera. Attachment of capilliconidia to the T. evansi body, presence of hyphal bodies in infected T. evansi and mortality from fungal infection were significantly higher on pepper, nightshade and tomato. The highest level of T. evansi mummification was observed on tomato. T. evansi cadavers from tomato and eggplant produced more primary conidia than those from cherry tomato, nightshade and pepper. Switching N. floridana infected T. evansi from one of five Solanaceous host plants to tomato had no prominent effect on N. floridana performance. For T. urticae, strawberry and jack bean provided the best N. floridana performance when considering all measured parameters. Strawberry also had the highest primary conidia production. This study shows that performance of N. floridana can vary with host plants and may be an important factor for the development of N. floridana epizootics. (C) 2011 Elsevier Inc. All rights reserved.

Prepenetration Stages of Guignardia psidii in Guava: Effects of Temperature, Wetness Duration and Fruit Age

This study examined the effects of temperature and wetness duration in vitro and in vivo as well as the effects of fruit age on germination and appressoria formation by conidia of Guignardia psidii, the causal agent of black spot disease in guava fruit. The temperatures tested for in vitro and in vivo experiments were 10, 15, 20, 25, 30, 35 and 40 degrees C. The wetness periods studied were 6, 12, 24, 36 and 48 h in vitro and 6, 12 and 24 h in vivo. Fruit 10, 35, 60, 85 and 110-days old were inoculated and maintained at 25 degrees C, with a wetness period of 24 h. Temperature and wetness duration affected the variables evaluated in vitro and in vivo. All variables reached their maximum values at between 25 and 30 degrees C with a wetness duration of 24 h in vivo and 48 h in vitro. These conditions resulted in 31.3% conidia germination, 33.6% appressoria formation and 32.5% appressoria melanization in vitro, and 50.4% conidia germination and 9.5% appressoria formation in vivo. Fruit age also influenced these factors. As fruit age increased, conidia germination and appressoria formation gradually increased. Conidia germination and appressoria formation were 10.8% and 2.3%, respectively, in 10-day-old fruits. In 110-day-old fruits, conidia germination and appressoria formation were 42.5% and 23.2% respectively.

Development of Ramulosis Disease of Cotton Under Controlled Environment and Field Conditions

Colletotrichum gossypii var. cephalosporioides, the fungus that causes ramulosis disease of cotton, is widespread in Brazil and can cause severe yield loss. Because weather conditions greatly affect disease development, the objective of this work was to develop weather-based models to assess disease favorability. Latent period, incidence, and severity of ramulosis symptoms were evaluated in controlled environment experiments using factorial combinations of temperature (15, 20, 25, 30, and 35 degrees C) and leaf wetness duration (0, 4, 8, 16, 32, and 64 h after inoculation). Severity was modeled as an exponential function of leaf wetness duration and temperature. At the optimum temperature of disease development, 27 degrees C, average latent period was 10 days. Maximum ramulosis severity occurred from 20 to 30 degrees C, with sharp decreases at lower and higher temperatures. Ramulosis severity increased as wetness periods were increased from 4 to 32 h. In field experiments at Piracicaba, Sao Paulo State, Brazil, cotton plots were inoculated (10(5) conidia ml(-1)) and ramulosis severity was evaluated weekly. The model obtained from the controlled environment study was used to generate a disease favorability index for comparison with disease progress rate in the field. Hourly measurements of solar radiation, temperature, relative humidity, leaf wetness duration, rainfall, and wind speed were also evaluated as possible explanatory variables. Both the disease favorability model and a model based on rainfall explained ramulosis growth rate well, with R(2) of 0.89 and 0.91, respectively. They are proposed as models of ramulosis development rate on cotton in Brazil, and weather-disease relationships revealed by this work can form the basis of a warning system for ramulosis development.

Silencing of mitochondrial alternative oxidase gene of Aspergillus fumigatus enhances reactive oxygen species production and killing of the fungus by macrophages

We previously demonstrated that conidia from Aspergillus fumigatus incubated with menadione and paraquat increases activity and expression of cyanide-insensitive alternative oxidase (AOX). Here, we employed the RNA silencing technique in A. fumigatus using the vector pALB1/aoxAf in order to down-regulate the aox gene. Positive transformants for aox gene silencing of A. fumigatus were more susceptible both to an imposed in vitro oxidative stress condition and to macrophages killing, suggesting that AOX is required for the A. fumigatus pathogenicity, mainly for the survival of the fungus conidia during host infection and resistance to reactive oxygen species generated by macrophages.

Variability in UVB Tolerances of Melanized and Nonmelanized Cells of Cryptococcus neoformans and C-laurentii

Solar radiation is one of the major factors responsible for the control of fungus populations in the environment. Inactivation by UVA and UVB radiation is especially important for the control of fungi that disperse infective units through the air, including fungi such as Cryptococcus spp. that infect their vertebrate hosts by inhalation. Cryptococcus neoformans produces melanin in the presence of certain exogenous substrates such as l-3,4 dihydroxyphenylalanine and melanization may protect the fungus against biotic and abiotic environmental factors. In the present study, we investigated the effect of exposure to an UVB irradiance of 1000 mW m(-2) (biologically effective weighted irradiance) on the survival of melanized and nonmelanized cells of four strains of C. neoformans and four strains of C. laurentii. The relative survival (survival of cells exposed to radiation in relation to cells not exposed) of cells grown 2, 4, 6 or 8 days on medium with or without L-dopa was determined after exposure to UVB doses of 1.8 and 3.6 kJ m(-2). Both the irradiance spectrum and the intensities of those doses are environmentally realistic, and, in fact, occur routinely during summer months in temperate regions. Differences in tolerance to UVB radiation were observed between the C. neoformans and C. laurentii strains. The C. neoformans strains were more susceptible to UVB radiation than the C. laurentii strains. In C. neoformans, differences in tolerance to radiation were observed during development of both melanized and nonmelanized cells. For most treatments (strain, time of growth and UVB dose), there were virtually no differences in tolerances between melanized and nonmelanized cells, but when differences occurred they were smaller than those previously observed with UVC. In tests with two strains of C. laurentii, there was no difference in tolerance to UVB radiation between melanized and nonmelanized cells during 8 days of culture; and in tests with four strains for less culture time (4 days) there were no significant differences in tolerance between melanized and nonmelanized cells of any strain of this species.

Fungal tyrosine betaine, a novel secondary metabolite from conidia of entomopathogenic Metarhizium spp. fungi

Fungi, including the entomopathogenic deuteromycete Metarhizium anisopliae, produce a wide diversity of secondary metabolites that either can be secreted or stored in specific developmental structures, e.g., conidia. Some secondary metabolites, such as pigments, polyols and mycosporines, are associated with pathogenicity and/or fungal tolerance to several stress-inducing environmental factors, including temperature and solar radiation extremes. Extracts of M. anisopliae var. anisopliae (strain ESALQ-1037) conidia were purified by chromatographic procedures and the isolated compounds analyzed by (1)H and (13)C nuclear magnetic resonance spectroscopy and high-resolution mass spectrometry. LC-MS analyses were carried out to search for mycosporines (the initial targets), but no compounds of this class were detected. A molecule whose natural occurrence was previously undescribed was identified. It consists of betaine conjugated with tyrosine, and the structure was identified as 2-([1-carboxy-2-(4-hydroxyphenyl)ethyl]amino)-N,N,N-trimethyl-2-oxoethanammonium. mannitol was the predominant compound in the alcoholic conidial extract, but no amino acids other than tyrosine were found to be conjugated with betaine in conidia. The fungal tyrosine betaine was detected also in conidial extracts of three other M. anisopliae var. anisopliae (ARSEF 1095, 5626 and 5749) and three M. anisopliae var. acridum isolates (ARSEF 324, 3391 and 7486), but it was not detected in Aspergillus nidulans conidial extract (ATCC 10074). (C) 2010 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.

Evaluation of synergistic interactions between the Colorado potato beetle (Coleoptera : Chrysomelidae) pathogen Beauveria bassiana and the insecticides, imidacloprid, and cyromazine

Laboratory studies investigated the interaction between the fungal entomopathogen Beauveria bassiana (Balsamo) Vuillemin and sublethal doses of the insecticides imidacloprid and cyromazine when applied to larvae of the Colorado potato beetle, Leptinotarsa decemlinenta (Say). When second instars were fed potato leaf discs treated with sublethal doses of imidacloprid and a range of doses of B. bassiana, a synergistic action was demonstrated. Similar results were observed when larvae were sprayed directly with B. bassiana conidia and immediately fed leaf discs treated with imidacloprid. No synergistic interaction was detected when larvae were fed leaf discs treated with sublethal doses of imidacloprid 24 h after application of R. bassiana conidia to larvae. However, a synergistic interaction was detected when larvae were fed leaf discs treated with imidacloprid and sprayed with B, bassiana conidia 24 h later. Although sublethal doses of both imidacloprid and the triazine insect growth regulator (IGR) cyromazine prolonged the duration of the second instar, only imidacloprid interacted with B. bassiana to produce a synergistic response in larval mortality. In leaf consumption studies, the highest dose of B, bassiana tested promoted feeding in inoculated second instars. Feeding was inhibited when larvae were fed foliage treated with sublethal doses of imidacloprid and significantly reduced when fed foliage treated with a sublethal dose of cyromazine. Starvation of larvae for 24 h immediately after B. bassiana treatment produced a similar result to the combined treatment of B. bassiana and imidacloprid and increased the level of mycosis when compared with B. bassiana controls. Imidacloprid treatment affected neither the rate of germination of B. bassiana conidia on the insect cuticle nor the rate at which conidia were removed from the integument after application. The statistical analysis used to detect synergism and the possible role of starvation-induced stress factors underlying the observed synergistic interactions are discussed.

Antagonism of the two-needle pine stem rust fungi Cronartium flaccidum and Peridermium pini by Cladosporium tenuissimum in vitro and in planta

Selected isolates of Cladosporium tenuissimum were tested for their ability to inhibit in vitro aeciospore germination of the two-needle pine stem rusts Cronartium flaccidum and Peridermium pini and to suppress disease development in planta. The antagonistic fungus displayed a number of disease-suppressive mechanisms. Aeciospore germination on water agar slides was reduced at 12, 18, and 24 h when a conidial suspension (1.5 x 10(7) conidia per ml) of the Cladosporium tenuissimum isolates was added. When the aeciospores were incubated in same-strength conidial suspensions for 1, 11, 21, and 31 days, viability was reduced at 20 and 4 degreesC. Light and scanning electron microscopy showed that rust spores were directly parasitized by Cladosporium tenuissimum and that the antagonist had evolved several strategies to breach the spore wail and gain access to the underlying tissues. Penetration occurred with or without appressoria. The hyperparasite exerted a mechanical force to destroy the spore structures (spinules, cell wall) by direct contact, penetrated the aeciospores and subsequently proliferated within them. However, an enzymatic action could also be involved. This was shown by the dissolution of the host tell wall that comes in contact with the mycelium of the mycoparasite, by the lack of indentation in the host wall at the contact site, and by the minimal swelling at the infecting hyphal tip. Culture filtrates of the hyperparasite inhibited germination of rust propagules. A compound purified from the filtrates was characterized by chemical and spectroscopic analysis as cladosporol, a known beta -1,3-glucan biosynthesis inhibitor. Conidia of Cladosporium tenuissimum reduced rust development on new infected pine seedlings over 2 years under greenhouse conditions. Because the fungus is an aggressive mycoparasite, produces fungicidal metabolites, and can survive and multiply in forest ecosystems without rusts, it seems a promising agent for the biological control of pine stem rusts in Europe.