996 resultados para Block Detection


Relevância:

30.00% 30.00%

Publicador:

Resumo:

Traffic incidents are non-recurring events that can cause a temporary reduction in roadway capacity. They have been recognized as a major contributor to traffic congestion on our nation’s highway systems. To alleviate their impacts on capacity, automatic incident detection (AID) has been applied as an incident management strategy to reduce the total incident duration. AID relies on an algorithm to identify the occurrence of incidents by analyzing real-time traffic data collected from surveillance detectors. Significant research has been performed to develop AID algorithms for incident detection on freeways; however, similar research on major arterial streets remains largely at the initial stage of development and testing. This dissertation research aims to identify design strategies for the deployment of an Artificial Neural Network (ANN) based AID algorithm for major arterial streets. A section of the US-1 corridor in Miami-Dade County, Florida was coded in the CORSIM microscopic simulation model to generate data for both model calibration and validation. To better capture the relationship between the traffic data and the corresponding incident status, Discrete Wavelet Transform (DWT) and data normalization were applied to the simulated data. Multiple ANN models were then developed for different detector configurations, historical data usage, and the selection of traffic flow parameters. To assess the performance of different design alternatives, the model outputs were compared based on both detection rate (DR) and false alarm rate (FAR). The results show that the best models were able to achieve a high DR of between 90% and 95%, a mean time to detect (MTTD) of 55-85 seconds, and a FAR below 4%. The results also show that a detector configuration including only the mid-block and upstream detectors performs almost as well as one that also includes a downstream detector. In addition, DWT was found to be able to improve model performance, and the use of historical data from previous time cycles improved the detection rate. Speed was found to have the most significant impact on the detection rate, while volume was found to contribute the least. The results from this research provide useful insights on the design of AID for arterial street applications.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The superoxide radical is considered to play important roles in physiological processes as well as in the genesis of diverse cytotoxic conditions such as cancer, various cardiovascular disorders and neurodegenerative diseases such as amyotrophic lateral sclerosis (ALS), Parkinson’s disease (PD) and Alzheimer’s disease (AD). The detection and quantification of superoxide within cells is of critical importance to understand biological roles of superoxide and to develop preventive strategies against free radical-mediated diseases. Cyclic nitrone spin traps such as DMPO, EMPO, DEPMPO, BMPO and their derivatives have been widely used in conjunction with ESR spectroscopy to detect cellular superoxide with some success. However, the formation of unstable superoxide adducts from the reaction of cyclic nitrones with superoxide is a stumbling block in detecting superoxide by using electron spin resonance (ESR). A chemiluminescent probe, lucigenin, and fluorogenic probes, hydroethidium and MitoSox, are the other frequently used methods in detecting superoxide. However, luceginen undergoes redox-cycling producing superoxide by itself, and hydroethidium and MitoSox react with other oxidants apart from superoxide forming red fluorescent products contributing to artefacts in these assays. Hence, both methods were deemed to be inappropriate for superoxide detection. In this study, an effective approach, a selective mechanism-based colorimetric detection of superoxide anion has been developed by using silylated azulenyl nitrones spin traps. Since a nitrone moiety and an adjacent silyl group react readily with radicals and oxygen anions respectively, such nitrones can trap superoxide efficiently because superoxide is both a radical and an oxygen anion. Moreover, the synthesized nitrone is designed to be triggered solely by superoxide and not by other commonly observed oxygen radicals such as hydroxyl radical, alkoxyl radicals and peroxyl radical. In vitro studies have shown that these synthesized silylated azylenyl nitrones and the mitochondrial-targeted guanylhydrazone analog can trap superoxide efficiently yielding UV-vis identifiable and even potentially fluorescence-detectable orange products. Therefore, the chromotropic detection of superoxide using these nitrones can be a promising method in contrast to other available methods.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The present study investigated the development of sensitivity to temporal synchrony between sounds of impact and pauses in the movement of an object by infants of 2 1/2, 4 and 6 months of age. Ninety infants were tested across four experiments with side-by-side videos of a red and white square and a blue and yellow triangle along with a centralized soundtrack which was synchronized with only one of the films. This preference phase was then followed by a search phase, where the two films were accompanied by intermittent bursts of the soundtrack from each object. Twomonth- olds showed no evidence of matching films and soundtracks on the basis of synchrony, however 4-month-olds looked more on the second block of trials to the object which paused when the sound occurred and directed more first looks during the preference phase to the matching object. Six-month-olds demonstrated significantly more first looks to the mismatched object during the search phase only. These results suggest that infants relate impact sounds with synchronous pauses in continuous motion by the age of four months.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Traffic incidents are non-recurring events that can cause a temporary reduction in roadway capacity. They have been recognized as a major contributor to traffic congestion on our national highway systems. To alleviate their impacts on capacity, automatic incident detection (AID) has been applied as an incident management strategy to reduce the total incident duration. AID relies on an algorithm to identify the occurrence of incidents by analyzing real-time traffic data collected from surveillance detectors. Significant research has been performed to develop AID algorithms for incident detection on freeways; however, similar research on major arterial streets remains largely at the initial stage of development and testing. This dissertation research aims to identify design strategies for the deployment of an Artificial Neural Network (ANN) based AID algorithm for major arterial streets. A section of the US-1 corridor in Miami-Dade County, Florida was coded in the CORSIM microscopic simulation model to generate data for both model calibration and validation. To better capture the relationship between the traffic data and the corresponding incident status, Discrete Wavelet Transform (DWT) and data normalization were applied to the simulated data. Multiple ANN models were then developed for different detector configurations, historical data usage, and the selection of traffic flow parameters. To assess the performance of different design alternatives, the model outputs were compared based on both detection rate (DR) and false alarm rate (FAR). The results show that the best models were able to achieve a high DR of between 90% and 95%, a mean time to detect (MTTD) of 55-85 seconds, and a FAR below 4%. The results also show that a detector configuration including only the mid-block and upstream detectors performs almost as well as one that also includes a downstream detector. In addition, DWT was found to be able to improve model performance, and the use of historical data from previous time cycles improved the detection rate. Speed was found to have the most significant impact on the detection rate, while volume was found to contribute the least. The results from this research provide useful insights on the design of AID for arterial street applications.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The cobas® (Roche) portfolio of companion diagnostics in oncology currently has three assays CE-marked for in vitro diagnostics. Two of these (EGFR and BRAF) are also US FDA-approved. These assays detect clinically relevant mutations that are correlated with response (BRAF, EGFR) or lack of response (KRAS) to targeted therapies such as selective mutant BRAF inhibitors in malignant melanoma, tyrosine kinases inhibitor in non-small cell lung cancer and anti-EGFR monoclonal antibodies in colorectal cancer, respectively. All these assays are run on a single platform using DNA extracted from a single 5 µm section of a formalin-fixed paraffin-embedded tissue block. The assays provide an ‘end-to-end’ solution from extraction of DNA to automated analysis and report on the cobas z 480. The cobas tests have shown robust and reproducible performance, with high sensitivity and specificity and low limit of detection, making them suitable as companion diagnostics for clinical use.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

We consider an LTE network where a secondary user acts as a relay, transmitting data to the primary user using a decode-and-forward mechanism, transparent to the base-station (eNodeB). Clearly, the relay can decode symbols more reliably if the employed precoder matrix indicators (PMIs) are known. However, for closed loop spatial multiplexing (CLSM) transmit mode, this information is not always embedded in the downlink signal, leading to a need for effective methods to determine the PMI. In this thesis, we consider 2x2 MIMO and 4x4 MIMO downlink channels corresponding to CLSM and formulate two techniques to estimate the PMI at the relay using a hypothesis testing framework. We evaluate their performance via simulations for various ITU channel models over a range of SNR and for different channel quality indicators (CQIs). We compare them to the case when the true PMI is known at the relay and show that the performance of the proposed schemes are within 2 dB at 10% block error rate (BLER) in almost all scenarios. Furthermore, the techniques add minimal computational overhead over existent receiver structure. Finally, we also identify scenarios when using the proposed precoder detection algorithms in conjunction with the cooperative decode-and-forward relaying mechanism benefits the PUE and improves the BLER performance for the PUE. Therefore, we conclude from this that the proposed algorithms as well as the cooperative relaying mechanism at the CMR can be gainfully employed in a variety of real-life scenarios in LTE networks.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

To assess binocular detection grating acuity using the LEA GRATINGS test to establish age-related norms in healthy infants during their first 3 months of life. In this prospective, longitudinal study of healthy infants with clear red reflex at birth, responses to gratings were measured at 1, 2, and 3 months of age using LEA gratings at a distance of 28 cm. The results were recorded as detection grating acuity values, which were arranged in frequency tables and converted to a one-octave scale for statistical analysis. For the repeated measurements, analysis of variance (ANOVA) was used to compare the detection grating acuity results between ages. A total of 133 infants were included. The binocular responses to gratings showed development toward higher mean values and spatial frequencies, ranging from 0.55 ± 0.70 cycles per degree (cpd), or 1.74 ± 0.21 logMAR, in month 1 to 3.11 ± 0.54 cpd, or 0.98 ± 0.16 logMAR, in month 3. Repeated ANOVA indicated differences among grating acuity values in the three age groups. The LEA GRATINGS test allowed assessment of detection grating acuity and its development in a cohort of healthy infants during their first 3 months of life.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A novel capillary electrophoresis method using capacitively coupled contactless conductivity detection is proposed for the determination of the biocide tetrakis(hydroxymethyl)phosphonium sulfate. The feasibility of the electrophoretic separation of this biocide was attributed to the formation of an anionic complex between the biocide and borate ions in the background electrolyte. Evidence of this complex formation was provided by (11) B NMR spectroscopy. A linear relationship (R(2) = 0.9990) between the peak area of the complex and the biocide concentration (50-900 μmol/L) was found. The limit of detection and limit of quantification were 15.0 and 50.1 μmol/L, respectively. The proposed method was applied to the determination of tetrakis(hydroxymethyl)phosphonium sulfate in commercial formulations, and the results were in good agreement with those obtained by the standard iodometric titration method. The method was also evaluated for the analysis of tap water and cooling water samples treated with the biocide. The results of the recovery tests at three concentration levels (300, 400, and 600 μmol/L) varied from 75 to 99%, with a relative standard deviation no higher than 9%.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Infections of the central nervous systems (CNS) present a diagnostic problem for which an accurate laboratory diagnosis is essential. Invasive practices, such as cerebral biopsy, have been replaced by obtaining a polymerase chain reaction (PCR) diagnosis using cerebral spinal fluid (CSF) as a reference method. Tests on DNA extracted from plasma are noninvasive, thus avoiding all of the collateral effects and patient risks associated with CSF collection. This study aimed to determine whether plasma can replace CSF in nested PCR analysis for the detection of CNS human herpesvirus (HHV) diseases by analysing the proportion of patients whose CSF nested PCR results were positive for CNS HHV who also had the same organism identified by plasma nested PCR. In this study, CSF DNA was used as the gold standard, and nested PCR was performed on both types of samples. Fifty-two patients with symptoms of nervous system infection were submitted to CSF and blood collection. For the eight HHV, one positive DNA result-in plasma and/or CSF nested PCR-was considered an active HHV infection, whereas the occurrence of two or more HHVs in the same sample was considered a coinfection. HHV infections were positively detected in 27/52 (51.9%) of the CSF and in 32/52 (61.5%) of the plasma, difference not significant, thus nested PCR can be performed on plasma instead of CSF. In conclusion, this findings suggest that plasma as a useful material for the diagnosis of cases where there is any difficulty to perform a CSF puncture.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The aim of this study was to develop a methodology using Raman hyperspectral imaging and chemometric methods for identification of pre- and post-blast explosive residues on banknote surfaces. The explosives studied were of military, commercial and propellant uses. After the acquisition of the hyperspectral imaging, independent component analysis (ICA) was applied to extract the pure spectra and the distribution of the corresponding image constituents. The performance of the methodology was evaluated by the explained variance and the lack of fit of the models, by comparing the ICA recovered spectra with the reference spectra using correlation coefficients and by the presence of rotational ambiguity in the ICA solutions. The methodology was applied to forensic samples to solve an automated teller machine explosion case. Independent component analysis proved to be a suitable method of resolving curves, achieving equivalent performance with the multivariate curve resolution with alternating least squares (MCR-ALS) method. At low concentrations, MCR-ALS presents some limitations, as it did not provide the correct solution. The detection limit of the methodology presented in this study was 50μgcm(-2).

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A rapid and low cost method to determine Cr(VI) in soils based upon alkaline metal extraction at room temperature is proposed as a semi-quantitative procedure to be performed in the field. A color comparison with standards with contents of Cr(VI) in the range of 10 to 150 mg kg-1 was used throughout. For the different types of soils studied, more than 75% of the fortified soluble Cr(VI) were recovered for all levels of spike tested for both the proposed and standard methods. Recoveries of 83 and 99% were obtained for the proposed and the standard methods, respectively, taking into account the analysis of a heavily contaminated soil sample.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Previous studies indicated that patients with atherosclerosis are predominantly infected by human cytomegalovirus (HCMV), but rarely infected by type 1 Epstein-Barr virus (EBV-1). In this study, atheromas of 30 patients who underwent aortocoronary bypass surgery with coronary endartherectomy were tested for the presence of these two viruses. HCMV occurred in 93.3% of the samples and EBV-1 was present in 50% of them. Concurrent presence of both pathogens was detected in 43.3% of the samples.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Secondary caries has been reported as the main reason for restoration replacement. The aim of this in vitro study was to evaluate the performance of different methods - visual inspection, laser fluorescence (DIAGNOdent), radiography and tactile examination - for secondary caries detection in primary molars restored with amalgam. Fifty-four primary molars were photographed and 73 suspect sites adjacent to amalgam restorations were selected. Two examiners evaluated independently these sites using all methods. Agreement between examiners was assessed by the Kappa test. To validate the methods, a caries-detector dye was used after restoration removal. The best cut-off points for the sample were found by a Receiver Operator Characteristic (ROC) analysis, and the area under the ROC curve (Az), and the sensitivity, specificity and accuracy of the methods were calculated for enamel (D2) and dentine (D3) thresholds. These parameters were found for each method and then compared by the McNemar test. The tactile examination and visual inspection presented the highest inter-examiner agreement for the D2 and D3 thresholds, respectively. The visual inspection also showed better performance than the other methods for both thresholds (Az = 0.861 and Az = 0.841, respectively). In conclusion, the visual inspection presented the best performance for detecting enamel and dentin secondary caries in primary teeth restored with amalgam.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Onion (Allium cepa) is one of the most cultivated and consumed vegetables in Brazil and its importance is due to the large laborforce involved. One of the main pests that affect this crop is the Onion Thrips (Thrips tabaci), but the spatial distribution of this insect, although important, has not been considered in crop management recommendations, experimental planning or sampling procedures. Our purpose here is to consider statistical tools to detect and model spatial patterns of the occurrence of the onion thrips. In order to characterize the spatial distribution pattern of the Onion Thrips a survey was carried out to record the number of insects in each development phase on onion plant leaves, on different dates and sample locations, in four rural properties with neighboring farms under different infestation levels and planting methods. The Mantel randomization test proved to be a useful tool to test for spatial correlation which, when detected, was described by a mixed spatial Poisson model with a geostatistical random component and parameters allowing for a characterization of the spatial pattern, as well as the production of prediction maps of susceptibility to levels of infestation throughout the area.