Quantitative evaluation of artifact removal in real magnetoencephalogram signals with blind source separation

The magnetoencephalogram (MEG) is contaminated with undesired signals, which are called artifacts. Some of the most important ones are the cardiac and the ocular artifacts (CA and OA, respectively), and the power line noise (PLN). Blind source separation (BSS) has been used to reduce the influence of the artifacts in the data. There is a plethora of BSS-based artifact removal approaches, but few comparative analyses. In this study, MEG background activity from 26 subjects was processed with five widespread BSS (AMUSE, SOBI, JADE, extended Infomax, and FastICA) and one constrained BSS (cBSS) techniques. Then, the ability of several combinations of BSS algorithm, epoch length, and artifact detection metric to automatically reduce the CA, OA, and PLN were quantified with objective criteria. The results pinpointed to cBSS as a very suitable approach to remove the CA. Additionally, a combination of AMUSE or SOBI and artifact detection metrics based on entropy or power criteria decreased the OA. Finally, the PLN was reduced by means of a spectral metric. These findings confirm the utility of BSS to help in the artifact removal for MEG background activity.

An implementation of nonlinear multiuser detection in Rayleigh fading channel

A blind nonlinear interference cancellation receiver for code-division multiple-access- (CDMA-) based communication systems operating over Rayleigh flat-fading channels is proposed. The receiver which assumes knowledge of the signature waveforms of all the users is implemented in an asynchronous CDMA environment. Unlike the conventional MMSE receiver, the proposed blind ICA multiuser detector is shown to be robust without training sequences and with only knowledge of the signature waveforms. It has achieved nearly the same performance of the conventional training-based MMSE receiver. Several comparisons and experiments are performed based on examining BER performance in AWGN and Rayleigh fading in order to verify the validity of the proposed blind ICA multiuser detector.

Blind multiuser receiver for DS-CDMA wireless system

We consider blind signal detection in an asynchronous code-division multiple-access (CDMA) system employing short spreading sequences in the presence of unknown multipath fading. This approach is capable of countering the presence of multiple-access interference (MAI) in CDMA fading channels. The proposed blind multiuser detector is based on an independent component analysis (ICA) to mitigate both MAI and noise. This algorithm has been utilised in blind source separation (BSS) of unknown sources from their mixtures. It can also be used for estimating the basis vectors of BSS. The aim is to include an ICA algorithm within a wireless receiver in order to reduce the level of interference in wideband systems. This blind multiuser detector requires no training sequence compared with the conventional multiuser detection receiver. The proposed ICA blind multiuser detector is made robust with respect to knowledge of signature waveforms and the timing of the user of interest. Several experiments are performed in order to verify the validity of the proposed ICA algorithm.

Improved sampling, pre-concentration, and detection of hidden explosives and illicit drugs by a novel solid phase microextraction geometry coupled to ion mobility spectrometry

The 9/11 Act mandates the inspection of 100% of cargo shipments entering the U.S. by 2012 and 100% inspection of air cargo by March 2010. So far, only 5% of inbound shipping containers are inspected thoroughly while air cargo inspections have fared better at 50%. Government officials have admitted that these milestones cannot be met since the appropriate technology does not exist. This research presents a novel planar solid phase microextraction (PSPME) device with enhanced surface area and capacity for collection of the volatile chemical signatures in air that are emitted from illicit compounds for direct introduction into ion mobility spectrometers (IMS) for detection. These IMS detectors are widely used to detect particles of illicit substances and do not have to be adapted specifically to this technology. For static extractions, PDMS and sol-gel PDMS PSPME devices provide significant increases in sensitivity over conventional fiber SPME. Results show a 50–400 times increase in mass detected of piperonal and a 2–4 times increase for TNT. In a blind study of 6 cases suspected to contain varying amounts of MDMA, PSPME-IMS correctly detected 5 positive cases with no false positives or negatives. One of these cases had minimal amounts of MDMA resulting in a false negative response for fiber SPME-IMS. A La (dihed) phase chemistry has shown an increase in the extraction efficiency of TNT and 2,4-DNT and enhanced retention over time. An alternative PSPME device was also developed for the rapid (seconds) dynamic sampling and preconcentration of large volumes of air for direct thermal desorption into an IMS. This device affords high extraction efficiencies due to strong retention properties under ambient conditions resulting in ppt detection limits when 3.5 L of air are sampled over the course of 10 seconds. Dynamic PSPME was used to sample the headspace over the following: MDMA tablets (12–40 ng detected of piperonal), high explosives (Pentolite) (0.6 ng detected of TNT), and several smokeless powders (26–35 ng of 2,4-DNT and 11–74 ng DPA detected). PSPME-IMS technology is flexible to end-user needs, is low-cost, rapid, sensitive, easy to use, easy to implement, and effective. ^

Anomaly Detection in Noisy Images

Finding rare events in multidimensional data is an important detection problem that has applications in many fields, such as risk estimation in insurance industry, finance, flood prediction, medical diagnosis, quality assurance, security, or safety in transportation. The occurrence of such anomalies is so infrequent that there is usually not enough training data to learn an accurate statistical model of the anomaly class. In some cases, such events may have never been observed, so the only information that is available is a set of normal samples and an assumed pairwise similarity function. Such metric may only be known up to a certain number of unspecified parameters, which would either need to be learned from training data, or fixed by a domain expert. Sometimes, the anomalous condition may be formulated algebraically, such as a measure exceeding a predefined threshold, but nuisance variables may complicate the estimation of such a measure. Change detection methods used in time series analysis are not easily extendable to the multidimensional case, where discontinuities are not localized to a single point. On the other hand, in higher dimensions, data exhibits more complex interdependencies, and there is redundancy that could be exploited to adaptively model the normal data. In the first part of this dissertation, we review the theoretical framework for anomaly detection in images and previous anomaly detection work done in the context of crack detection and detection of anomalous components in railway tracks. In the second part, we propose new anomaly detection algorithms. The fact that curvilinear discontinuities in images are sparse with respect to the frame of shearlets, allows us to pose this anomaly detection problem as basis pursuit optimization. Therefore, we pose the problem of detecting curvilinear anomalies in noisy textured images as a blind source separation problem under sparsity constraints, and propose an iterative shrinkage algorithm to solve it. Taking advantage of the parallel nature of this algorithm, we describe how this method can be accelerated using graphical processing units (GPU). Then, we propose a new method for finding defective components on railway tracks using cameras mounted on a train. We describe how to extract features and use a combination of classifiers to solve this problem. Then, we scale anomaly detection to bigger datasets with complex interdependencies. We show that the anomaly detection problem naturally fits in the multitask learning framework. The first task consists of learning a compact representation of the good samples, while the second task consists of learning the anomaly detector. Using deep convolutional neural networks, we show that it is possible to train a deep model with a limited number of anomalous examples. In sequential detection problems, the presence of time-variant nuisance parameters affect the detection performance. In the last part of this dissertation, we present a method for adaptively estimating the threshold of sequential detectors using Extreme Value Theory on a Bayesian framework. Finally, conclusions on the results obtained are provided, followed by a discussion of possible future work.

The Lea Grating Test In Assessing Detection Grating Acuity In Normal Infants Less Than 4 Months Of Age.

To assess binocular detection grating acuity using the LEA GRATINGS test to establish age-related norms in healthy infants during their first 3 months of life. In this prospective, longitudinal study of healthy infants with clear red reflex at birth, responses to gratings were measured at 1, 2, and 3 months of age using LEA gratings at a distance of 28 cm. The results were recorded as detection grating acuity values, which were arranged in frequency tables and converted to a one-octave scale for statistical analysis. For the repeated measurements, analysis of variance (ANOVA) was used to compare the detection grating acuity results between ages. A total of 133 infants were included. The binocular responses to gratings showed development toward higher mean values and spatial frequencies, ranging from 0.55 ± 0.70 cycles per degree (cpd), or 1.74 ± 0.21 logMAR, in month 1 to 3.11 ± 0.54 cpd, or 0.98 ± 0.16 logMAR, in month 3. Repeated ANOVA indicated differences among grating acuity values in the three age groups. The LEA GRATINGS test allowed assessment of detection grating acuity and its development in a cohort of healthy infants during their first 3 months of life.

Determination Of Tetrakis(hydroxymethyl)phosphonium Sulfate In Commercial Formulations And Cooling Water By Capillary Electrophoresis With Contactless Conductivity Detection.

A novel capillary electrophoresis method using capacitively coupled contactless conductivity detection is proposed for the determination of the biocide tetrakis(hydroxymethyl)phosphonium sulfate. The feasibility of the electrophoretic separation of this biocide was attributed to the formation of an anionic complex between the biocide and borate ions in the background electrolyte. Evidence of this complex formation was provided by (11) B NMR spectroscopy. A linear relationship (R(2) = 0.9990) between the peak area of the complex and the biocide concentration (50-900 μmol/L) was found. The limit of detection and limit of quantification were 15.0 and 50.1 μmol/L, respectively. The proposed method was applied to the determination of tetrakis(hydroxymethyl)phosphonium sulfate in commercial formulations, and the results were in good agreement with those obtained by the standard iodometric titration method. The method was also evaluated for the analysis of tap water and cooling water samples treated with the biocide. The results of the recovery tests at three concentration levels (300, 400, and 600 μmol/L) varied from 75 to 99%, with a relative standard deviation no higher than 9%.

Human Herpesvirus Infections Of The Central Nervous System: Laboratory Diagnosis Based On Dna Detection By Nested Pcr In Plasma And Cerebrospinal Fluid Samples.

Infections of the central nervous systems (CNS) present a diagnostic problem for which an accurate laboratory diagnosis is essential. Invasive practices, such as cerebral biopsy, have been replaced by obtaining a polymerase chain reaction (PCR) diagnosis using cerebral spinal fluid (CSF) as a reference method. Tests on DNA extracted from plasma are noninvasive, thus avoiding all of the collateral effects and patient risks associated with CSF collection. This study aimed to determine whether plasma can replace CSF in nested PCR analysis for the detection of CNS human herpesvirus (HHV) diseases by analysing the proportion of patients whose CSF nested PCR results were positive for CNS HHV who also had the same organism identified by plasma nested PCR. In this study, CSF DNA was used as the gold standard, and nested PCR was performed on both types of samples. Fifty-two patients with symptoms of nervous system infection were submitted to CSF and blood collection. For the eight HHV, one positive DNA result-in plasma and/or CSF nested PCR-was considered an active HHV infection, whereas the occurrence of two or more HHVs in the same sample was considered a coinfection. HHV infections were positively detected in 27/52 (51.9%) of the CSF and in 32/52 (61.5%) of the plasma, difference not significant, thus nested PCR can be performed on plasma instead of CSF. In conclusion, this findings suggest that plasma as a useful material for the diagnosis of cases where there is any difficulty to perform a CSF puncture.

Detection Of Explosives On The Surface Of Banknotes By Raman Hyperspectral Imaging And Independent Component Analysis.

The aim of this study was to develop a methodology using Raman hyperspectral imaging and chemometric methods for identification of pre- and post-blast explosive residues on banknote surfaces. The explosives studied were of military, commercial and propellant uses. After the acquisition of the hyperspectral imaging, independent component analysis (ICA) was applied to extract the pure spectra and the distribution of the corresponding image constituents. The performance of the methodology was evaluated by the explained variance and the lack of fit of the models, by comparing the ICA recovered spectra with the reference spectra using correlation coefficients and by the presence of rotational ambiguity in the ICA solutions. The methodology was applied to forensic samples to solve an automated teller machine explosion case. Independent component analysis proved to be a suitable method of resolving curves, achieving equivalent performance with the multivariate curve resolution with alternating least squares (MCR-ALS) method. At low concentrations, MCR-ALS presents some limitations, as it did not provide the correct solution. The detection limit of the methodology presented in this study was 50μgcm(-2).

A screening method for detection of hexavalent chromium levels in soils

A rapid and low cost method to determine Cr(VI) in soils based upon alkaline metal extraction at room temperature is proposed as a semi-quantitative procedure to be performed in the field. A color comparison with standards with contents of Cr(VI) in the range of 10 to 150 mg kg-1 was used throughout. For the different types of soils studied, more than 75% of the fortified soluble Cr(VI) were recovered for all levels of spike tested for both the proposed and standard methods. Recoveries of 83 and 99% were obtained for the proposed and the standard methods, respectively, taking into account the analysis of a heavily contaminated soil sample.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

1. Jogos Escolares Brasileiros da Confederação Brasileira de Desportos para Cegos : um estudo de caso

Universidade Estadual de Campinas . Faculdade de Educação Física

Short-Term effect of COX-2 selective inhibitor as an adjunct for the treatment of periodontal disease: a clinical double-blind study in humans

Adjunctive therapeutic strategies that modulate the inflammatory mediators can play a significant role in periodontal therapy. In this double-blind, placebo-controlled study, 60 subjects diagnosed as periodontitis patients were evaluated for 28 days after periodontal treatment combined with selective cyclooxygenase-2 (COX-2) inhibitor. The experimental group received scaling and root planning (SRP) combined with the Loxoprofen antiinflammatory drug (SRP+Loxoprofen). The control group received SRP combined with placebo (SRP+placebo). Plaque index (PI), probing pocket depth (PD) and bleeding on probing (BOP) were monitored with an electronic probe at baseline and after 14 and 28 days. Both groups displayed clinical improvement in PD, PI and BOP. They also showed statistically similar values (p>0.05) of PD reduction on day 14 (0.4 mm) and on day 28 (0.6 mm). At the baseline, few deeper sites (>7 mm) from SRP+Loxoprofen group were responsible and most PD reduction was observed after 14 days (p<0.05). The percentage of remaining deep pockets (>7 mm) after 14 days in the SRP+Loxoprofen group was significantly lower (p<0.05) than in the SRP+placebo group. Loxoprofen presents potential effect as an adjunct of periodontal disease treatment, but long-term clinical trials are necessary to confirm its efficacy.

Detection of human cytomegalovirus and Epstein-Barr virus in coronary atherosclerotic tissue

Previous studies indicated that patients with atherosclerosis are predominantly infected by human cytomegalovirus (HCMV), but rarely infected by type 1 Epstein-Barr virus (EBV-1). In this study, atheromas of 30 patients who underwent aortocoronary bypass surgery with coronary endartherectomy were tested for the presence of these two viruses. HCMV occurred in 93.3% of the samples and EBV-1 was present in 50% of them. Concurrent presence of both pathogens was detected in 43.3% of the samples.

Double-blind, crossover, placebo-controlled clinical trial with clobetasol propionate in desquamative gingivitis

The aim of this study was to evaluate the efficacy of a 0.05% clobetasol propionate ointment administered in trays to 22 patients with desquamative gingivitis in a double-blind, crossover, placebo-controlled trial. Patients received container number 1 and were instructed to apply the ointment 3 times a day for 2 weeks, and to reduce the application to once a day in the third week. Next, the patients were then instructed to discontinue the treatment for 2 weeks, and were then given container 2, used in the same way and for the same length of time as container 1. Regarding signs, 17 patients presented some improvement, while 5 experienced worsening with clobetasol propionate. With the placebo, 14 patients presented some improvement, and 8 patients presented worsening. For symptoms, there was complete improvement in 2 patients, partial improvement in 12, no response in 7, and worsening in 1 with clobetasol propionate. With the placebo, there was partial improvement in 8 patients, no response in 12 and worsening in 2. No statistically significant difference was found between clobetasol and placebo (p>0.05). Within the period designed to treat the gingival lesions of the patients, clobetasol propionate did not significantly outperform the placebo.