985 resultados para anthophilous insects


Relevância:

10.00% 10.00%

Publicador:

Resumo:

Genetically modified foods are a major concern around the world due to the lack of information concerning their safety and health effects. This work evaluates differences, at the proteomic level, between two types of crop samples: transgenic (MON810 event with the Cry1Ab gene, which confers resistance to insects) and non-transgenic maize flour commercialized in Brazil. The 2-D DIGE technique revealed 99 differentially expressed spots, which were collected in 2-D PAGE gels and identified via mass spectrometry (nESI-QTOF MS/MS). The abundance of protein differences between the transgenic and non-transgenic samples could arise from genetic modification or as a result of an environmental influence pertaining to the commercial sample. The major functional category of proteins identified was related to disease/defense and, although differences were observed between samples, no toxins or allergenic proteins were found.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

In insects that utilize patchy and ephemeral resources for feeding and egg laying, the outcome of larval competition for food resources depends on the amount of resources and the spatial distribution of immatures among patches of food. In the present study, the results of larval competition for food in Chrysomya megacephala, in traits such as female weight, fecundity and reproductive investment, were different in situations where the level of larval aggregation (proportion of competitors per amount of food) was the same, but with densities of competitors and amounts of food proportionally different. These results are indicative that the larval competition may depend both on the larval density and the amount of food, in different situations with the same proportion of larvae per gram of food.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física

Relevância:

10.00% 10.00%

Publicador:

Resumo:

This study describes the sperm morphology of the mayfly Hexagenia (Pseudeatonica) albivitta (Ephemeroptera). Its spermatozoon measures approximately 30 μm of which 9 μm corresponds to the head. The head is composed of an approximately round acrosomal vesicle and a cylindrical nucleus. The nucleus has two concavities, one in the anterior tip, where the acrosomal vesicle is inserted and a deeper one at its base, where the flagellum components are inserted. The flagellum is composed of an axoneme, a mitochondrion and a dense rod adjacent to the mitochondrion. A centriolar adjunct is also observed surrounding the axoneme in the initial portion of the flagellum and extends along the flagellum for at least 2 μm, surrounding the axoneme in a half-moon shape. The axoneme is the longest component of the flagellum, and it follows the 9+9+0 pattern, with no central pair of microtubules. At the posterior region of the flagellum, the mitochondrion has a dumb-bell shape in cross sections that, together with the rectangular mitochondrial-associated rod, is responsible for the flattened shape of the flagellum. An internal membrane is observed surrounding both mitochondrion and its associated structure.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Onion (Allium cepa) is one of the most cultivated and consumed vegetables in Brazil and its importance is due to the large laborforce involved. One of the main pests that affect this crop is the Onion Thrips (Thrips tabaci), but the spatial distribution of this insect, although important, has not been considered in crop management recommendations, experimental planning or sampling procedures. Our purpose here is to consider statistical tools to detect and model spatial patterns of the occurrence of the onion thrips. In order to characterize the spatial distribution pattern of the Onion Thrips a survey was carried out to record the number of insects in each development phase on onion plant leaves, on different dates and sample locations, in four rural properties with neighboring farms under different infestation levels and planting methods. The Mantel randomization test proved to be a useful tool to test for spatial correlation which, when detected, was described by a mixed spatial Poisson model with a geostatistical random component and parameters allowing for a characterization of the spatial pattern, as well as the production of prediction maps of susceptibility to levels of infestation throughout the area.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

In specialized literature, reports on anatomy of miners in host plants are few in number. These agents trigger excavations, or paths, by consumption of plant inner tissues by larvae of several insects. The aim of this work was to investigate leaf miner occurrence in Commelina diffusa (a cosmopolitan plant) and Floscopa glabrata (an amphibious plant) using anatomical techniques. The place where the plants were collected is subjected to seasonal floods, consequently both the species were exposed to the same weather conditions and seasonal floods. This study showed that members of Agromyzidae and Chironomidae families, which are Diptera endophytophagous larvae types, were responsible for the tunnels. Moreover, in Commelina diffusa Agromyzidae larvae were found, while in Floscopa glabrata three Chironomidae cephalic exuviae were found. The miners, as can be seen from anatomical studies, used only mesophyll parenchyma tissues for feeding, causing the formation of linear mines. In addition, in both the species, the epidermis and the medium-sized vascular units were kept intact, showing no structural modification, such as neoformation of tissues.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

At present a complete mtDNA sequence has been reported for only two hymenopterans, the Old World honey bee, Apis mellifera and the sawfly Perga condei. Among the bee group, the tribe Meliponini (stingless bees) has some distinction due to its Pantropical distribution, great number of species and large importance as main pollinators in several ecosystems, including the Brazilian rain forest. However few molecular studies have been conducted on this group of bees and few sequence data from mitochondrial genomes have been described. In this project, we PCR amplified and sequenced 78% of the mitochondrial genome of the stingless bee Melipona bicolor (Apidae, Meliponini). The sequenced region contains all of the 13 mitochondrial protein-coding genes, 18 of 22 tRNA genes, and both rRNA genes (one of them was partially sequenced). We also report the genome organization (gene content and order), gene translation, genetic code, and other molecular features, such as base frequencies, codon usage, gene initiation and termination. We compare these characteristics of M. bicolor to those of the mitochondrial genome of A. mellifera and other insects. A highly biased A+T content is a typical characteristic of the A. mellifera mitochondrial genome and it was even more extreme in that of M. bicolor. Length and compositional differences between M. bicolor and A. mellifera genes were detected and the gene order was compared. Eleven tRNA gene translocations were observed between these two species. This latter finding was surprising, considering the taxonomic proximity of these two bee tribes. The tRNA Lys gene translocation was investigated within Meliponini and showed high conservation across the Pantropical range of the tribe.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Wolbachia are endosymbiont bacteria of the family Rickettsiacea that are widespread in invertebrates and occur between 20% and 60% of Neotropical insects. These bacteria are responsible for reproductive phenomena such as cytoplasmic incompatibility, male killing, feminization and parthenogenesis. Supergroups A and B of Wolbachia are common in insects and can be identified using primers for 16S rDNA, ftsZ and wsp; these primers vary in their ability to detect Wolbachia. The ftsZ primer was the first primer used to detect Wolbachia in Anastrepha fruit flies. The primers for 16S rDNA, ftsZ and wsp and the corresponding PCR conditions have been optimized to study the distribution of Wolbachia and their effect on the biology of Anastrepha in Brazil. In this work, we examined the ability of these primers to detect Wolbachia in Anastrepha populations from three regions in the State of São Paulo, southeastern Brazil. All of the samples were positive for Wolbachia supergroup A when screened with primers for 16S A rDNA and wsp A; the wsp B primer also gave a positive result, indicating cross-reactivity. The ftsZ primer showed a poor ability to detect Wolbachia in Anastrepha and generated false negatives in 44.9% of the samples. These findings indicate that reliable PCR detection of Wolbachia requires the use of primers for 16S rDNA and wsp to avoid cross-reactions and false negatives, and that the ftsZ primer needs to be redesigned to improve its selectivity.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Piperaceae species have been placed among the basal angiosperm and are adapted to a variety of habitats including moist forests, secondary vegetation and dry high lands. The major anatomical/morphology features are of small trees, vines, and shrubs for Piper species, while the epiphytic and succulent characteristics are predominant forms among Peperomia species. Their secondary chemistry can be mostly represented by amides, phenylpropanoids/lignoids, and chromenes in addition to a phletoria of biosynthetically mixed-origin secondary compounds. Although several amides and lignans are known as insecticides, several phytophagous insects, among which some considered pests of economic importance, have been observed feeding vigorously on Piperaceae species. Herein we describe the feeding preferences of fourteen phytophagous species of Coleoptera, Lepidoptera and Hemiptera over approximately fifty Piperaceae species observed in São Paulo, SP, Brazil, in a long-term basis.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

On the first tachinid fly (Diptera, Tachinidae) carrying Asclepiadoideae pollinaria in the Neotropical Region. This paper reports the first Neotropical Tachinidae species possibly associated to pollination of Asclepiadoideae: a female of Euacaulona sumichrasti Townsend, 1908 (Diptera, Tachinidae, Phasiinae, Trichopodini) carrying pollinaria of Gonolobus parviflorus Decne., 1844 (Apocynaceae, Asclepiadoideae, Asclepiadeae: Gonolobinae) attached to its proboscis. The fly specimen was collected in Paraguay, Departamento Canindeyú. The pollinarium is illustrated and described herein. This represents the first anthophilous record to G. parviflorus and to the genus.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

A group of 18 research workers involved in different aspects of the biology of Lutzomyia longipalpis discussed whether or not it is important to give taxonomically valid names to populations that have been defined by biological, biochemical and molecular methods to be reproductively isolated. The type material of this medically important species has been lost and because of this it was recommended that a colony should be established from insects captured in the region of the type area and that their description should serve as the basis for future descriptions. It was pointed out that there is a lack of uniformity in the naming of closely related American sand flies and that some of the differences between populations of Lu. longipalpis are greater than those between accepted species. The majority of the participants agreed that the populations that have been defined in the literature as sibling species should be named.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Encontrados no Brasil desde os primórdios da colonização portuguesa, os presépios logo tiveram de adaptar-se à realidade local, circunstância muito propícia ao aparecimento de concepções heterodoxas e ao emprego de elementos exóticos da fauna e flora de cada região. Como registros envolvendo insetos são muito pouco comuns, chama a atenção que fêmeas de saúva, Atta sp. (Hymenoptera, Formicidae), tenham sido aproveitadas na composição de presépios no estado de São Paulo. Tendo subsistido pelo menos até a década 1960, os "presépios de formigas" existentes em cidades como Embu das Artes poderiam estar relacionados às "formigas vestidas" criadas por Jules Martin, curiosa manufatura paulistana do último quartel do século XIX.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The identification of the sandfly fauna and investigation of some ecological aspects of its populations in areas frequented by tourists of the PEI, an Atlantic forest reserve with many caves, were the objective of this study. Captures were undertaken monthly from January 2001 to December 2002, with automatic light traps installed in 13 ecotopes, including caves, forests, domiciliary and peridomiciliary environments, and by aspiration in armadillo burrows. Additionally, although not at regular intervals, Shannon traps were installed in forests and anthropic environments, aspirations were made on cave walls, among roots and fallen leaves, and some insects were captured while biting researchers. A total of 891 sandflies belonging to 21 species were captured. Six hundred specimens representing 19 species were captured with light traps, 215 in anthropic (2.24 insects/trap) and 385 in extra-domiciliary (1.46 insects/trap) environments. Brumptomyia troglodytes was the most abundant species (the Standardised Index of Species Abundance = 0.705). Pintomyia monticola predominated in the Shannon traps and showed anthropophilic and diurnal activity. Psathyromyia pascalei predominated in the aspirations; the largest number being in armadillo burrows. Eleven species were captured in caves; although some might be troglophiles, the majority used these ecotopes as resting places. Nyssomyia intermedia, Nyssomyia neivai and Migonemyia migonei, implicated in the transmission of cutaneous leishmaniasis in the Southeastern Brazilian region, were all found, though in such low densities as to suggest minimal risk of the disease in the PEI.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The blood feeding of a population of Cx. nigripalpus from Parque Ecológico do Tietê (PET) was investigated using an indirect ELISA protocol. Mosquitoes were captured outside houses. Five hundred sixteen engorged females collected in a reforested area and 25 in an open area were tested. Rodents and dogs were the most common blood sources, accounting for approximately 65.3% of blood meals. Human blood was detected in 10.9%, dog blood in 26.1%, chicken blood in 2.4%, and rodent blood in 39.2% of the 541 insects tested. ELISA failed in identifying the blood sources of 233 engorged females, indicating that the mosquitoes may have fed on a host which was not tested. One hundred six individuals were positive for more than one host. The unweighted human blood index was 0.14 and the rodent/human, human/chicken, and dog/rodent feeding index values were 2.70, 1.51, and 1.33, respectively. Furthermore, rodents are defensive hosts for this haematophagous insect which looks for another host to complete blood-feeding. Considering that rodents are potential reservoirs for Mucambo virus and Saint Louis encephalitis virus and that Cx. nigripalpus feed on the blood of those mammals, we hypothesize that mosquito population in PET could participate in the transmission cycle of those arboviruses. Additionally, this species might be involved in the transmission of Dirofilaria immitis to dogs at this area.